ID: 1079939117

View in Genome Browser
Species Human (GRCh38)
Location 11:26655936-26655958
Sequence GGCAGGAATCTGTCTCATTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 132}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079939110_1079939117 21 Left 1079939110 11:26655892-26655914 CCAGATGAAAAGGCAAGATAGGA 0: 1
1: 0
2: 2
3: 11
4: 196
Right 1079939117 11:26655936-26655958 GGCAGGAATCTGTCTCATTAAGG 0: 1
1: 0
2: 1
3: 8
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079939117 Original CRISPR GGCAGGAATCTGTCTCATTA AGG Intronic
901486162 1:9563722-9563744 AGCAGGACTCTGTCTCAGAAAGG - Intronic
903328658 1:22585893-22585915 GCCAGGAATCTGTATTTTTATGG + Intronic
905856063 1:41314987-41315009 GACAGACATCTGTCTCATTGGGG - Intergenic
906473835 1:46153531-46153553 GGCTGAAATCTGCCTCCTTAAGG + Intronic
906612135 1:47210865-47210887 GGCAGGAGTCTGACTCACTTGGG - Intergenic
906796648 1:48701351-48701373 GGCAGGTGTCTGCCTCATTTTGG + Intronic
910139519 1:84011897-84011919 TGAAGGAATCTGTCTCACTTTGG - Intergenic
911469513 1:98300071-98300093 TGCAGGAACCTTTTTCATTAAGG - Intergenic
918053599 1:180998281-180998303 TGGAGGAATCTGCCTCATCAGGG - Intronic
919929336 1:202211042-202211064 GGAAGGAATGTGTCTCATTGTGG + Intronic
921425783 1:214999526-214999548 GGCAGGACTGTGTCTCTTTGTGG - Intergenic
1064339568 10:14474128-14474150 GGCACAAATCTGTCTCCTTTTGG + Intergenic
1065906615 10:30259480-30259502 GGCAGGATTCTGTCTGGTTTTGG - Intergenic
1066463661 10:35634468-35634490 GGCAAGAACCTGTGGCATTAGGG - Intergenic
1072946911 10:99818691-99818713 GGAAGAAATTTGTCTCAATAAGG - Intronic
1073589934 10:104747302-104747324 GGAAGTAATCAGTCACATTAAGG + Intronic
1074407119 10:113189080-113189102 GGCATCAATCTCTCTCATGAGGG + Intergenic
1075933273 10:126317717-126317739 GCCAGGAATTTGGCTCTTTATGG - Intronic
1077910047 11:6565638-6565660 GGGAGGAATCAGACTCCTTAGGG - Intronic
1078534847 11:12164646-12164668 GGCTGGAATCTGTCTCTTCCAGG + Intronic
1079939117 11:26655936-26655958 GGCAGGAATCTGTCTCATTAAGG + Intronic
1081429785 11:42963884-42963906 GGTAGGTATCTGTCTCCTGAAGG + Intergenic
1082175783 11:49057361-49057383 TGCAGGACTATGTGTCATTAAGG - Exonic
1085248611 11:75125832-75125854 GGCAGGAATCTCTCTAATTTTGG - Intronic
1085378930 11:76094862-76094884 GGCTGGGCTCTTTCTCATTAGGG + Intronic
1085764115 11:79267781-79267803 AGTAGGTATTTGTCTCATTAGGG + Intronic
1085825357 11:79841140-79841162 GACAACACTCTGTCTCATTAAGG - Intergenic
1086050790 11:82588095-82588117 GGCCAGAATCTGTCTGACTAGGG - Intergenic
1086689962 11:89778708-89778730 TGCAGGACTATGTGTCATTAAGG + Intergenic
1086715892 11:90061247-90061269 TGCAGGACTATGTGTCATTAAGG - Intergenic
1089297293 11:117477818-117477840 GGCAGGCATCTGTCACATCCTGG - Intronic
1089334285 11:117712351-117712373 GGAAGGAATCTGTACCATTTGGG + Intronic
1090853417 11:130590561-130590583 GGTAAGATGCTGTCTCATTATGG + Intergenic
1093917913 12:24826149-24826171 GGCATGAACCTGGCTCATTGTGG - Intronic
1094222837 12:28012921-28012943 GGCAGCCACCTGTCTCATTCAGG - Intergenic
1094410218 12:30160407-30160429 GGCACTAATCTGACTCATGAGGG + Intergenic
1100470855 12:94891611-94891633 GGAAGGAAACTTTCTCATTAGGG - Intergenic
1108911232 13:55553866-55553888 GGCAGCAATCTGTGTAATGAAGG + Intergenic
1109687576 13:65842044-65842066 GGCATTAATCTGTTTCATGAGGG - Intergenic
1110086070 13:71381233-71381255 GGCAGGAATGTGGCTCACTGCGG - Intergenic
1115695925 14:35898459-35898481 GGCAGGATGCAGTCTCATGATGG + Intronic
1118716728 14:68564974-68564996 GGCTGGAATCTGGCTCAGTGAGG - Intronic
1121816140 14:96930120-96930142 GGCATGCATATGCCTCATTACGG + Intronic
1122424079 14:101595576-101595598 GGCAGGACTCTGTCGCATGGGGG + Intergenic
1129129067 15:73474702-73474724 GACAGAAATCTCTTTCATTATGG + Intronic
1130399132 15:83532931-83532953 GGTAGTCATATGTCTCATTATGG - Intronic
1130996081 15:88905061-88905083 TGCAGAAATCTGTCCCTTTATGG + Intronic
1135867351 16:26116136-26116158 GGCAGGATTCAGTTTCATTTGGG + Intronic
1140958975 16:79894501-79894523 GCCAAGAAGCTGTCTCCTTAGGG - Intergenic
1142415493 16:89938963-89938985 GGCAGGAATGGGCCTAATTAAGG + Intergenic
1144395706 17:14841046-14841068 GTCAGGAAAATGTCTGATTAAGG + Intergenic
1147426248 17:40347211-40347233 GGCAGGGATCTGTCTACCTAGGG + Intronic
1149154403 17:53609018-53609040 GGCATGAATATGTGTTATTAGGG - Intergenic
1151711385 17:75808987-75809009 GGCATGAAGCTGTCTCCTTTTGG - Intronic
1152563885 17:81091634-81091656 GGCAGGAGTCTGGCCCATTCGGG + Intronic
1158172307 18:54613669-54613691 GGCATGAATCTCACTCATGAGGG - Intergenic
1159186038 18:64975622-64975644 GGAAGGAAACTACCTCATTATGG + Intergenic
1159994807 18:74953844-74953866 AGCAGGAATCTGGTCCATTAGGG + Intronic
1160286196 18:77546129-77546151 GGCAGGAATATGTCTCTTCTGGG - Intergenic
1166810416 19:45510870-45510892 GGCAAGAATATGACTCATTGCGG - Intronic
925803012 2:7620072-7620094 GAAAGGAATCTGGGTCATTAAGG + Intergenic
926795744 2:16617560-16617582 GGCTGGTAGCTGCCTCATTAAGG + Intronic
926826278 2:16908104-16908126 GGCAGGAAACTGGCTTAATACGG - Intergenic
928010920 2:27606806-27606828 GGCTGGAATCTGTGTCGGTAGGG + Intronic
929465983 2:42144373-42144395 GGCAGAAATCTCTCTGATGAAGG - Intergenic
929676745 2:43940832-43940854 GACAGCAATCCGTCACATTAAGG - Intronic
931876122 2:66514760-66514782 GGAAGGAATCTTTTTCATTGGGG - Intronic
934587564 2:95516507-95516529 TGCAGGACTATGTGTCATTAAGG + Intergenic
938870831 2:135474428-135474450 GGGAGGAATCTGGCTCATGGGGG + Intronic
939696748 2:145335239-145335261 TGCAAGAATCTATCTCATGAGGG + Intergenic
941139987 2:161768231-161768253 GGCTGAAATCTGTCTCACTGTGG - Intronic
941698195 2:168575861-168575883 GGCAGGTATTTGTCACAGTAGGG - Intronic
942084341 2:172429589-172429611 GCCAGGAATCTGTGTCGTGAAGG + Intronic
1172642165 20:36447025-36447047 GGGAGGAATCTGTCTCAGGCTGG + Intronic
1178160768 21:29911673-29911695 GGCACTAATCTCACTCATTATGG - Intronic
1182897187 22:33868629-33868651 GGGAGGAATCTGCCTGGTTAGGG - Intronic
949353974 3:3158009-3158031 GCCAGAAATGTTTCTCATTAAGG - Intronic
950809497 3:15637339-15637361 GGCAGCCACATGTCTCATTATGG + Intronic
950990363 3:17430768-17430790 GGAAGGAAACTGTCTGACTATGG + Intronic
955028866 3:55197300-55197322 GGCAGGAATCTGTGCCACTCTGG - Intergenic
955100695 3:55846819-55846841 GGCAGGCAAATATCTCATTAAGG - Intronic
960646072 3:119885087-119885109 GGCAGGAACCTTTGTCTTTAGGG - Intronic
961232009 3:125322351-125322373 GCCAGCTATCTGTCACATTAAGG - Intronic
966700245 3:182841499-182841521 GGCAAGAATCTGGATCATTTTGG - Intronic
967772865 3:193353938-193353960 GGCAGGAATCTGTCTCACACTGG + Intronic
968114548 3:196079804-196079826 GGCTGGATTCTGTCTGATTTTGG - Intronic
971378588 4:26076015-26076037 GGCATTAATCTGTCTGCTTAGGG - Intergenic
971423964 4:26498482-26498504 AGCAGGACTCTGTCTCAAAAAGG - Intergenic
972790338 4:42365644-42365666 GGCAAGACTCTGTCTCAAAAAGG - Intergenic
973147054 4:46840222-46840244 GGCAAAAATCTGTATCAATAAGG + Intronic
974976937 4:68904023-68904045 TGCTGGAATATGTCCCATTAAGG + Intergenic
980274925 4:130637980-130638002 AGAAATAATCTGTCTCATTAAGG - Intergenic
980274926 4:130638017-130638039 GGCATTAATCTGTCTCATTAAGG - Intergenic
984112957 4:175643089-175643111 GGGAAGAATCGGTCTGATTATGG - Intronic
984260707 4:177441511-177441533 GGCAGGAACCTAACTCATTCTGG + Intronic
985707917 5:1412293-1412315 GACAGGAGCCTGTCTCAATATGG - Intronic
986337334 5:6765578-6765600 GGCAATCATCTGTCTCATTGTGG - Intergenic
990452996 5:55954165-55954187 GGCAGGAATCTCTCTGCTTAGGG + Intronic
992300540 5:75374713-75374735 GTCAGGAATCGATCTCATGAAGG + Intronic
994714351 5:103304062-103304084 AGCAGGAGTCTTTCTCATTTTGG + Intergenic
996221420 5:120937038-120937060 GGCAGGTCTCTGTCTCTTTCTGG + Intergenic
998402511 5:141855268-141855290 GGAAGGAATGTGTCTATTTAGGG - Intronic
1007281074 6:40713002-40713024 GCAAGGACTCTGCCTCATTATGG - Intergenic
1007308405 6:40925257-40925279 GAGATGAATGTGTCTCATTACGG - Intergenic
1011488516 6:87867817-87867839 TGCAGGACTCTGTCTAAATATGG - Intergenic
1014004922 6:116407114-116407136 CCCAGGAATCTGTCTTTTTAAGG - Intronic
1014358463 6:120443367-120443389 TGCAGAAATTTGTCTCAATATGG - Intergenic
1014410453 6:121111600-121111622 GGGAGGAAAATTTCTCATTATGG + Intronic
1014743170 6:125169624-125169646 GGTAGGAAGCTGTCCCATTCTGG - Intronic
1015415868 6:132947854-132947876 GTCTGGAATCTGTCTTTTTAAGG + Intergenic
1017058989 6:150463375-150463397 GGCAGGTAACTGGCTCATGAGGG - Intergenic
1018725973 6:166613902-166613924 GGGAGGAATCTGTGTCCTGAAGG - Intronic
1019228409 6:170535229-170535251 GGGAGGAAACTGTTTCCTTAAGG - Exonic
1019885655 7:3902471-3902493 GCCTGGAAGATGTCTCATTAAGG + Intronic
1026454164 7:70556273-70556295 GGGAGGTATCTGTGTCATGAGGG - Intronic
1032648662 7:133854070-133854092 GGCAGGCACCTGCCTCATCAGGG + Intronic
1032785345 7:135195931-135195953 AGCAAGACTCTGTCTCAATAAGG + Intronic
1033778334 7:144639377-144639399 AGCAGAAATCTGTTTCATTATGG + Intronic
1036080615 8:5551612-5551634 GGAAGTAATCTGTCACTTTATGG - Intergenic
1036439705 8:8770269-8770291 AGCAAGACTCTGTCTCATAAAGG + Intergenic
1037123924 8:15321681-15321703 GGCAGGAATTTGTGCCATTCAGG + Intergenic
1037150586 8:15630775-15630797 TTCAGGAATGTGTCTCATAATGG + Intronic
1038341542 8:26690293-26690315 GGTAGGAATCTGCGTAATTACGG + Intergenic
1038634807 8:29277025-29277047 TGCATGAAACTGTCTCCTTAAGG + Intergenic
1039761527 8:40582007-40582029 TGAAGGAATATGTTTCATTATGG - Intronic
1039897551 8:41726910-41726932 GGCAAGAGCCTTTCTCATTAAGG + Intronic
1041408262 8:57525728-57525750 GGCATGAATCAGTCTCATCCTGG - Intergenic
1046102292 8:109629055-109629077 GGCAGGAATATGGTGCATTATGG + Intronic
1047603263 8:126448758-126448780 GGCAAGAATCTGTCCCATCAAGG + Intergenic
1047768426 8:128010107-128010129 GGCAGGAATCAGTCACATAGAGG - Intergenic
1051222844 9:14868803-14868825 TGCAGGCATCTTTCTCTTTAGGG + Exonic
1052351343 9:27461382-27461404 GGCAGGAATCTCTTCCATTCTGG - Intronic
1053414007 9:37934814-37934836 GGCAGAAATCAATTTCATTAGGG - Intronic
1058322771 9:103654959-103654981 AACAGGAATATGTCTTATTAAGG + Intergenic
1060436887 9:123600973-123600995 GGCAGGAATTTGACTCATTCAGG + Intronic
1060559696 9:124532920-124532942 GGTAGGAATTTTTCTCATCAAGG - Intronic
1188795144 X:34455219-34455241 GGGAGGACTCTGTTTCACTAGGG + Intergenic
1193718713 X:84962855-84962877 TGCAGGAAACTGTCTCTTCAGGG - Intergenic
1194062987 X:89227598-89227620 GGCAGGATACAGTCCCATTATGG - Intergenic
1194307864 X:92270647-92270669 GGGAGGATACGGTCTCATTATGG + Intronic
1195327426 X:103769073-103769095 GGCAGGAGACAGTCTCAGTAGGG + Intergenic
1200716797 Y:6556266-6556288 GGCAGGATACAGTCCCATTATGG - Intergenic