ID: 1079939499

View in Genome Browser
Species Human (GRCh38)
Location 11:26660741-26660763
Sequence CAGTGTAATGGGAAAGAGGG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 408
Summary {0: 1, 1: 0, 2: 1, 3: 35, 4: 371}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079939491_1079939499 26 Left 1079939491 11:26660692-26660714 CCAGTCTCAGGGAGATATATGCT 0: 1
1: 0
2: 1
3: 7
4: 106
Right 1079939499 11:26660741-26660763 CAGTGTAATGGGAAAGAGGGTGG 0: 1
1: 0
2: 1
3: 35
4: 371
1079939493_1079939499 -9 Left 1079939493 11:26660727-26660749 CCTTCCATCAACTGCAGTGTAAT 0: 1
1: 0
2: 0
3: 14
4: 139
Right 1079939499 11:26660741-26660763 CAGTGTAATGGGAAAGAGGGTGG 0: 1
1: 0
2: 1
3: 35
4: 371

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079939499 Original CRISPR CAGTGTAATGGGAAAGAGGG TGG Exonic
900320725 1:2082242-2082264 CTGTGTATTTGGCAAGAGGGAGG + Intronic
901290199 1:8118149-8118171 CAGAGTAATGGCAGAGAGAGAGG - Intergenic
902737391 1:18410244-18410266 CAGTGTAATGGGAAGGCTTGGGG + Intergenic
902750580 1:18506802-18506824 AAGTGGAATGAGGAAGAGGGAGG - Intergenic
903533601 1:24051365-24051387 TAGTCTACTGGGAAAGAGAGAGG - Intergenic
904068896 1:27777528-27777550 CAGTACAAGGGGAAAGAGGCAGG - Intronic
904431733 1:30468753-30468775 CAGGGGAAGGGGAGAGAGGGTGG - Intergenic
904459788 1:30669452-30669474 AAGTGTAATTGTAAAGACGGCGG - Intergenic
904867295 1:33590580-33590602 GTGTGTGATGGGAAATAGGGAGG - Intronic
904989262 1:34578389-34578411 CAGAGTAAAGGGACAAAGGGTGG - Intergenic
905204252 1:36334027-36334049 CAGTGCTATGGGTAAAAGGGAGG - Intergenic
905273649 1:36803122-36803144 CAGTGAAATGGGATAGAGAGGGG + Intronic
905894095 1:41534120-41534142 CAGTGGTATAGGAGAGAGGGTGG - Intronic
906049369 1:42857795-42857817 CAGGCTAAGGGGGAAGAGGGAGG - Intergenic
908934824 1:69362656-69362678 CTGTCGAATGGGAAAGTGGGAGG - Intergenic
909989298 1:82202744-82202766 CAGAGTAATGGAAAGAAGGGAGG + Intergenic
911611997 1:99968207-99968229 CTGTTTATTGGGAAATAGGGAGG + Intergenic
912276092 1:108260598-108260620 CTGTGAAATGGAACAGAGGGAGG + Intergenic
912292136 1:108433760-108433782 CTGTGAAATGGAACAGAGGGAGG - Intronic
912448312 1:109753707-109753729 CTGTGTAATGGGCGAGGGGGAGG - Intronic
913380091 1:118201183-118201205 AAGGGTAATGGAGAAGAGGGAGG - Intergenic
913555075 1:119957907-119957929 CAGTGTAGTGGGAATGAGCATGG + Intronic
914454918 1:147827064-147827086 CAGTGTGATGGAAAACAGTGTGG - Intergenic
916171949 1:162008056-162008078 AAGTGTAATGGGTAAGAGCATGG + Intronic
918396731 1:184121069-184121091 CACTATGATGGGAAAGAAGGAGG + Intergenic
918479309 1:184960968-184960990 GAGTGTAGTGAGCAAGAGGGAGG - Intronic
919291201 1:195633479-195633501 CAGTATATTTGGAAAGTGGGAGG - Intergenic
920842836 1:209569184-209569206 AAGTGTAGGGGGAAACAGGGAGG - Intergenic
922046246 1:221948838-221948860 CAGGCTAAGGGGGAAGAGGGAGG - Intergenic
922656616 1:227390079-227390101 CAGTGGAATAGGCAACAGGGAGG + Intergenic
922751069 1:228070260-228070282 CAGTGTAAAGGGATAGTGTGGGG + Intergenic
923141036 1:231162022-231162044 GAGAGTAATGGGGAGGAGGGGGG - Intergenic
923265420 1:232309036-232309058 CAGTGTGGTGGGAAAGGGGAGGG - Intergenic
923847816 1:237756452-237756474 CAGTGGAATTGAAATGAGGGAGG - Intronic
924413165 1:243828398-243828420 GAGTGTAATGGTTAAGAGGATGG - Intronic
1062946296 10:1464570-1464592 CAGTGCACTGGAGAAGAGGGTGG + Intronic
1062946324 10:1464702-1464724 CAGTGCACTGGAGAAGAGGGTGG + Intronic
1062946352 10:1464834-1464856 CAGTGCACTGGAGAAGAGGGTGG + Intronic
1064267265 10:13835122-13835144 AAGTGTAATGGTTAAGAGGAGGG + Intronic
1064755917 10:18571791-18571813 CAGTGTAATGGAATGGAGGATGG - Intronic
1065376534 10:25048905-25048927 CAATGTTATGGGGAAAAGGGAGG + Intronic
1065817276 10:29493591-29493613 CAGTAAAATGGGAGAGAGGGAGG + Intronic
1065955575 10:30690886-30690908 CAGTAAAACGGGAGAGAGGGAGG - Intergenic
1068930701 10:62586272-62586294 CAGTGTAATGGGTAAAAGAATGG - Intronic
1069940478 10:71951947-71951969 CAGTGCTATGGGCAAAAGGGAGG + Intergenic
1070448611 10:76534425-76534447 CAGTGGAAAGGGAAAGAATGTGG - Intronic
1072001115 10:91196625-91196647 CAGTGTAATGGAAAGGAGCTGGG - Intronic
1072176958 10:92935804-92935826 CAGTGCAATAGGACTGAGGGTGG - Exonic
1073583742 10:104689578-104689600 CAGTGTAAGGGGAGTCAGGGAGG - Intronic
1074212267 10:111346488-111346510 CAGTGCAATGGGAGAAAGGTTGG - Intergenic
1074296245 10:112192092-112192114 CAGGGTAAGGGGTAGGAGGGTGG + Intronic
1075232036 10:120688641-120688663 ATGTGTAATGGGAAAAATGGTGG + Intergenic
1076361671 10:129894053-129894075 CAGGTTAATAGGAAGGAGGGGGG - Intronic
1076764742 10:132626983-132627005 CAGTGTAATGGTATTGAGGGGGG + Intronic
1077759481 11:5076569-5076591 CAGTGTAGTAGGAAAGAGTGAGG + Intergenic
1078916372 11:15782481-15782503 CAGAGTAATGGGATAGAGGCAGG + Intergenic
1079939499 11:26660741-26660763 CAGTGTAATGGGAAAGAGGGTGG + Exonic
1080179437 11:29406285-29406307 CAGTCCTATGGGGAAGAGGGAGG + Intergenic
1080564913 11:33499126-33499148 AACTGAAATGGGAAAGAGGAAGG - Intergenic
1081540429 11:44030785-44030807 CAGTGTAATGGAAAACTGGCTGG + Intergenic
1082196180 11:49308966-49308988 CAGTGTAATGGGAGAGAGAATGG + Intergenic
1082209757 11:49484328-49484350 CAGAGTATTGGGAAAAAGGACGG + Intergenic
1082780527 11:57284118-57284140 CAGTGCAAAGGGAAAGTGCGGGG + Intergenic
1083010027 11:59388242-59388264 CAGTGTACTGGGTAAGGGAGTGG + Intergenic
1085743091 11:79093535-79093557 CACTGTGATGGCAAAGTGGGAGG + Intronic
1086659645 11:89399241-89399263 CAGTGTAATGGGAGAGAGAATGG - Intronic
1087175661 11:95092687-95092709 GAGAGTATTGGGAGAGAGGGAGG + Intronic
1087675901 11:101161112-101161134 CAGAGTAATTGGAAAGAGAAAGG - Intergenic
1088627596 11:111741938-111741960 AAGTATTATGGGAAACAGGGAGG - Intronic
1089273763 11:117319235-117319257 AAGGGTAAGGGGAAAGAGTGAGG + Intronic
1089498513 11:118919620-118919642 CAGTGCAGTGAGAGAGAGGGAGG - Intronic
1089974880 11:122723811-122723833 CATTGTAATAGGAAGGAGGCAGG + Intronic
1091552913 12:1550396-1550418 CAGTGTGATGGGAAAATGCGGGG + Intronic
1091822983 12:3490585-3490607 GAGTGGCTTGGGAAAGAGGGTGG - Intronic
1092388890 12:8057776-8057798 AAGTGGAAGGAGAAAGAGGGTGG - Intergenic
1093024179 12:14231839-14231861 CAGGCTAAGGGGGAAGAGGGAGG - Intergenic
1093099271 12:15007875-15007897 CAGTGGAATGGGAAAGAGGTTGG + Intergenic
1093892743 12:24543205-24543227 CAGTCTAATGAGGAAGATGGAGG - Intergenic
1093945713 12:25107083-25107105 TAGTGGAATGGGAAAGGGTGAGG + Intronic
1094451246 12:30585093-30585115 CAGTGGAGTGGGAAAGGGTGGGG + Intergenic
1094465108 12:30744728-30744750 TAATGTAATGGGGAAGAGAGTGG - Intronic
1095129104 12:38516849-38516871 CACTGAAATGAGAAAAAGGGTGG + Intergenic
1095972450 12:47911758-47911780 CAGTGTAGTGGTAAAGAGCTTGG + Intronic
1096094122 12:48923481-48923503 CAGTGTTCTGGGAAAGGTGGTGG + Intronic
1096400217 12:51299721-51299743 CAGGGTAATGAGAAAGGGTGTGG + Intronic
1096464118 12:51838755-51838777 CAGTGGCCTGGGAAAGAGGTGGG + Intergenic
1096465019 12:51843652-51843674 CAGTGAGAGGGGACAGAGGGAGG + Intergenic
1096872108 12:54599488-54599510 CAGTGGAAGTGGAAACAGGGTGG + Intergenic
1098147773 12:67515470-67515492 CTGTGTGATGGGCAAGGGGGTGG + Intergenic
1099212416 12:79808248-79808270 CAGAGTAAGGGGAAAGTGGGAGG - Intronic
1099366335 12:81769116-81769138 GAGTGGGAGGGGAAAGAGGGTGG + Intergenic
1099849204 12:88070761-88070783 CAGAGAGATGGCAAAGAGGGAGG + Intronic
1101245214 12:102878379-102878401 CAGTGTAGTGGGGAAGGGGTTGG + Intronic
1102497493 12:113329674-113329696 TAGTGACATAGGAAAGAGGGTGG - Intronic
1104163118 12:126199897-126199919 TACTGTAATCGAAAAGAGGGAGG + Intergenic
1104565925 12:129883043-129883065 CAGGGAAAAGGGAAAGAAGGAGG + Intronic
1105032025 12:132890594-132890616 CAGGCTAATGGAGAAGAGGGAGG - Intronic
1105045847 12:133002573-133002595 CAGAGTCATGAGACAGAGGGAGG - Intronic
1105632040 13:22179133-22179155 GAGTGAAATGGGAAAGAGTGAGG - Intergenic
1106131507 13:26943444-26943466 ATGTGAAATGGGAAAGAGAGAGG + Intergenic
1106603224 13:31204821-31204843 CAGTGTGCTGGGAGAAAGGGTGG + Intronic
1107466332 13:40654043-40654065 AACTGTGATGAGAAAGAGGGTGG - Intronic
1107468395 13:40668530-40668552 GAGTGTAATTGGAAAGGTGGGGG - Intergenic
1107471644 13:40696715-40696737 CAGTGTAAAAGGGGAGAGGGGGG - Intergenic
1107679636 13:42834863-42834885 CAGTGTTAAGGGTAAGAGGGAGG - Intergenic
1107791029 13:44002441-44002463 CAGAATAATGGGAAATAGTGTGG - Intergenic
1108249375 13:48549681-48549703 CAGTGGAAAGGAAAAGAGTGAGG + Intergenic
1109284024 13:60390693-60390715 TAGTGTACTGGTTAAGAGGGTGG + Intergenic
1109646215 13:65261441-65261463 CAGTGAAATGGGAAAATGAGTGG - Intergenic
1110580529 13:77118390-77118412 CTGTGTACTAGGGAAGAGGGAGG + Intronic
1110894183 13:80728623-80728645 CAGTGTGATGGGGAAGATTGGGG + Intergenic
1111189386 13:84788853-84788875 CGGTATACTGGCAAAGAGGGTGG + Intergenic
1111918844 13:94389790-94389812 CAGTTTTATGGGGGAGAGGGAGG - Intronic
1112640453 13:101268057-101268079 CACTGTAGAGGGAAAGAGAGAGG - Intronic
1113291485 13:108911549-108911571 GAGTTGTATGGGAAAGAGGGAGG + Intronic
1114483008 14:23047123-23047145 CTGGGGAAGGGGAAAGAGGGAGG - Exonic
1116656152 14:47656275-47656297 CAGTGCAATAGGAAAGATGTAGG - Intronic
1117461801 14:55952748-55952770 CTCTGTAATTGGAAGGAGGGAGG + Intergenic
1117990159 14:61425131-61425153 CAGTGCAAAGGGAAAGTGAGGGG + Intronic
1118318519 14:64739845-64739867 CAGTGTGATGGGAATGAGAGGGG - Intronic
1118338642 14:64877067-64877089 CAGTGTGATAGGACAGAGGATGG - Intronic
1119523335 14:75302422-75302444 CAGAGTAAAGGGAAAGGGAGTGG - Intergenic
1119592293 14:75900835-75900857 CAGTGTTATGAGAACGAGGCAGG - Intronic
1121599286 14:95191155-95191177 CTGCTTAATGAGAAAGAGGGTGG - Exonic
1122342947 14:101040217-101040239 CAGGGTAAGTGGAAAGATGGTGG + Intergenic
1123430511 15:20211688-20211710 GAGTGGTTTGGGAAAGAGGGGGG - Intergenic
1126951310 15:53884809-53884831 AGGAGTAAAGGGAAAGAGGGGGG - Intergenic
1128544503 15:68558067-68558089 CAGTGGAATGGCAGGGAGGGTGG + Intergenic
1129244464 15:74271123-74271145 CAGGGTGATGGGCACGAGGGAGG + Intronic
1129318668 15:74761797-74761819 CAGTGCAATGGGGCGGAGGGGGG + Intergenic
1129713225 15:77832144-77832166 CAGTGTTCTGGGAAAAGGGGAGG + Intergenic
1132664596 16:1075863-1075885 CAGGGTAGGGGGAGAGAGGGAGG - Intergenic
1133757760 16:8775516-8775538 CAGTGTAGTGGGTAAGAGTATGG - Intronic
1134008808 16:10836021-10836043 CAGAGTAATGGGCAAGAGGCTGG - Intergenic
1135830582 16:25769331-25769353 CTGTGTAGTGGGAAAGAGAGAGG - Intronic
1137548643 16:49421599-49421621 CAGTGTGATTGGACAGAGGCAGG + Intergenic
1137564025 16:49522124-49522146 CAGTGGCATGGGGATGAGGGAGG + Intronic
1137683909 16:50372924-50372946 AAGTGTAATGGGGCAGACGGTGG + Intergenic
1139356728 16:66371265-66371287 CTGTGGAATGGGAAAGCGGTGGG + Intronic
1139924569 16:70479065-70479087 CAGTGTCATGGTAAAGAAGCCGG - Intronic
1141001525 16:80312768-80312790 CAGGGTGACGGGGAAGAGGGTGG - Intergenic
1141785860 16:86200418-86200440 GAGTTTAATGAGTAAGAGGGTGG - Intergenic
1142857079 17:2737084-2737106 CAGAGTCATGGGGAAGGGGGCGG - Intergenic
1144190130 17:12837969-12837991 CAGGGTGATGGGAAAGCGGAGGG - Intronic
1144261716 17:13528049-13528071 CCGTGTCATCGGAAAGAAGGAGG + Intronic
1144406057 17:14953726-14953748 TAGTGTGATGGGAAAGGAGGCGG + Intergenic
1144647217 17:16983360-16983382 TAGTGAAATGGGAAAGACTGGGG - Intergenic
1145843606 17:28018071-28018093 CAGTGAAATTGGATAGAGTGTGG + Intergenic
1146055065 17:29576831-29576853 CAGGGGAGTGGGAAGGAGGGTGG + Intronic
1146286024 17:31574680-31574702 CTTTGAAATGGGAGAGAGGGTGG + Intronic
1147468894 17:40638341-40638363 CAGTTTTATGGGAAAGACAGAGG + Intronic
1148663153 17:49352976-49352998 GAGTGCAATGGGACAGTGGGAGG + Intronic
1148979577 17:51560746-51560768 CAGTGGAATGGGAGATTGGGAGG - Intergenic
1149646456 17:58244981-58245003 CAGTGTAAAGGGACAGCGAGAGG - Intronic
1149794956 17:59510550-59510572 AAGTGCAGTGGGAAAGAAGGTGG + Intergenic
1151221308 17:72615146-72615168 CAGGGTGATGGGAGGGAGGGAGG - Intergenic
1151696862 17:75722274-75722296 CTGAGCCATGGGAAAGAGGGCGG - Intronic
1151831126 17:76551895-76551917 CTGTGAAATGGGAAGGTGGGGGG + Intronic
1151945857 17:77319529-77319551 CAGACTAATGGGACGGAGGGGGG + Intronic
1152016072 17:77751022-77751044 CAGAGCAATGGGAACGAGAGGGG + Intergenic
1153717247 18:7862612-7862634 AAGTAAAATGGGAAAGAGGAAGG + Intronic
1156342381 18:36221512-36221534 TAGTGGAATGGGAAAGGAGGAGG - Intronic
1156883263 18:42105739-42105761 AAGTGTAAAGGGATTGAGGGAGG - Intergenic
1158327275 18:56325447-56325469 CAGTGAAATGGGCCACAGGGAGG + Intergenic
1158588179 18:58758692-58758714 GAGTGTAGTGGGAAAGAGACTGG - Intergenic
1158823343 18:61186645-61186667 CAGAGTGATGGGAAAGAGTAGGG - Intergenic
1159654081 18:71011189-71011211 TATTTTAATGGGAAAGAGAGAGG - Intergenic
1159804706 18:72941904-72941926 CAGTGTGACGGGAAGGAGGCAGG + Intergenic
1160291642 18:77599942-77599964 CACTGTAAGGGGAAAGAACGAGG + Intergenic
1161202390 19:3022882-3022904 CACTGTAATGGGAAAGCTGCTGG + Intronic
1162745603 19:12796325-12796347 TAGTCTTATGGGGAAGAGGGTGG - Intronic
1163209443 19:15829720-15829742 CAGGCTAAGGGGGAAGAGGGAGG - Intergenic
1163454131 19:17396033-17396055 CAGTTTGATGGGAAAGGCGGGGG - Intergenic
1163883885 19:19949435-19949457 CAGTGCTATGGGCAAAAGGGAGG - Intergenic
1165059709 19:33199133-33199155 CGGGATAATGGGGAAGAGGGAGG - Intronic
1165439479 19:35816445-35816467 CAGTGAAAAGACAAAGAGGGAGG - Intergenic
1166022969 19:40049875-40049897 CACTGTAATGGGACAAAGTGGGG + Intronic
1166090049 19:40502957-40502979 CAGGGTAAAGGGACGGAGGGCGG + Intronic
1166349970 19:42192299-42192321 CAGGGAAGTGGGATAGAGGGTGG + Intronic
1166413827 19:42577258-42577280 AAGTGTAATGGGAAGGAAGTAGG - Intergenic
1167589217 19:50394170-50394192 CACTGTGACGGGGAAGAGGGTGG + Intronic
1167910351 19:52697031-52697053 CAGTGAGTTTGGAAAGAGGGTGG + Intergenic
925307541 2:2861038-2861060 CAGTGTCCTGGGAAAGGGGTAGG + Intergenic
925642988 2:6005318-6005340 CAGTGGGATGGGAGAGACGGTGG - Intergenic
925912385 2:8582362-8582384 CAGTGGAGGGGGAAAGAGGCTGG - Intergenic
927281590 2:21313372-21313394 AACTGGAAAGGGAAAGAGGGAGG + Intergenic
927536188 2:23861391-23861413 CAGTGTATTGGCTAAGAGAGTGG - Intronic
927784584 2:25964881-25964903 TCCTGTAATGGGGAAGAGGGAGG - Intronic
928572943 2:32627123-32627145 CTGGGCAATAGGAAAGAGGGAGG - Intergenic
928660593 2:33498394-33498416 CAATGTAATGGTAAAGAGCATGG - Intronic
929256726 2:39819139-39819161 CAGTGCAATGGGAACAAGGAGGG - Intergenic
929399466 2:41563282-41563304 CAGAGTAAAGGGAGAGAGGATGG - Intergenic
930363914 2:50414987-50415009 GAGAGTAATGGGAAAGATGAAGG - Intronic
930775754 2:55168491-55168513 CAGTGAAATAGGGATGAGGGTGG - Intergenic
931808987 2:65835631-65835653 CAGTGTCTTGGGAAAGAAGAAGG + Intergenic
932564970 2:72900491-72900513 CAGCGTGCTGGGAGAGAGGGAGG - Intergenic
933025666 2:77254870-77254892 CAGAGAAATAGGAAAGAGAGAGG + Intronic
933466092 2:82654214-82654236 CAGTTTCATGAGAAAGAGAGAGG - Intergenic
933632667 2:84674750-84674772 CAGTGCCATGGGGATGAGGGTGG + Intronic
934973656 2:98785150-98785172 CAATGTACTGAGAAGGAGGGAGG + Intergenic
935593017 2:104857724-104857746 CTCTGAAATGGGAAGGAGGGGGG + Exonic
935617160 2:105098161-105098183 CTGTGTAATGTGAAAAAGGATGG + Intronic
936718478 2:115218966-115218988 CAGTGTGATGGGTATGAGGATGG - Intronic
938995876 2:136677165-136677187 CAGTGTTATGGGAAAGAAAAGGG + Intergenic
939176253 2:138751037-138751059 CAGGGTAATGAGAAAGAGATGGG - Intronic
939179159 2:138783863-138783885 CAGTGTGAGGGGAAAAAGAGTGG + Intergenic
941304333 2:163843026-163843048 CAGTGCAATGGGGGAAAGGGTGG - Intergenic
941519353 2:166520008-166520030 CAGTGAAAGTGGAAAGAGAGTGG - Intergenic
941957030 2:171215310-171215332 CAGTTTCATAGGAAAGAGGATGG + Intronic
941970417 2:171344355-171344377 TAGTGTAATGGGTGAGAGCGTGG - Intronic
943390670 2:187263983-187264005 CTTTGTAATGGGGAAGAAGGTGG + Intergenic
944034569 2:195278211-195278233 CAGTGGACTGGGAGAGAGGCAGG - Intergenic
944497758 2:200325704-200325726 AATTGTAATGGGAAGGAGAGTGG + Intronic
946118103 2:217481733-217481755 CATATTAATGGGAAAGAGGGAGG - Intronic
948232729 2:236363726-236363748 AAATGTAATTTGAAAGAGGGAGG + Intronic
948483981 2:238268353-238268375 CAGTATGATGGGACTGAGGGAGG - Intronic
948684518 2:239661929-239661951 CAGTGTATCAGGAAGGAGGGCGG - Intergenic
1168792708 20:590622-590644 CAGTGTGATTGGAGAGAGGATGG + Intergenic
1168974237 20:1952257-1952279 CAGTATAGTGGGAAAGAATGAGG + Intergenic
1169864977 20:10190349-10190371 AAGTATAATGGGGAAGGGGGAGG - Intergenic
1172134057 20:32675401-32675423 CAGTGTGATGGGAAAAGTGGAGG - Intergenic
1172164000 20:32887663-32887685 CTGTGTCCTGGGGAAGAGGGAGG - Intronic
1172434785 20:34921301-34921323 CAGGGGAATGGGAGAGAGGAAGG - Intronic
1172603726 20:36200830-36200852 CAGAGGAAAGGGAAAGAGGGAGG - Intronic
1173485423 20:43437546-43437568 CAGTAAGATGGGAAAGATGGGGG + Intergenic
1174753392 20:53134813-53134835 GAGTGTAGTGGGAAAGGGGTGGG - Intronic
1176980788 21:15378570-15378592 CAATGTAATGGGAGAGAGGTTGG + Intergenic
1177101363 21:16900728-16900750 CAGTGTGAGGGGAAAGAATGAGG - Intergenic
1178030492 21:28520380-28520402 CAGTATATTTGGAGAGAGGGGGG + Intergenic
1178043011 21:28662370-28662392 CAGCGGAGGGGGAAAGAGGGAGG - Intergenic
1178264831 21:31133270-31133292 CAGAGTAATAGGAAAGAGAAGGG - Intronic
1178570190 21:33728718-33728740 CAAGGTAAAGGGAAAGAGGTGGG - Intronic
1181844333 22:25694582-25694604 CAGGGGGATGGGAAAGAAGGAGG - Intronic
1181907549 22:26211335-26211357 CAGTGAAATGGCAAAGAGTTTGG - Intronic
1183138617 22:35915033-35915055 CTCTGTAATGGCAAAGGGGGAGG - Intronic
1183285619 22:36960890-36960912 AAGTGGAATGAGAATGAGGGTGG - Intergenic
1183340719 22:37279591-37279613 CAGCGTTGTGGGAAAGAGGGAGG + Intergenic
1184196809 22:42935301-42935323 CAGGGGAAAGGGAAACAGGGAGG - Intronic
1185081658 22:48712788-48712810 CACAGGAATGGGAAGGAGGGCGG - Intronic
950514965 3:13459168-13459190 GAGTTGAATGGGCAAGAGGGAGG - Intergenic
951280499 3:20743236-20743258 CTGTGTACTTGGAATGAGGGAGG + Intergenic
951711351 3:25586983-25587005 CAGTGTAGCGGTTAAGAGGGTGG + Intronic
952794247 3:37224791-37224813 CAGGGAGATTGGAAAGAGGGTGG + Intergenic
952804569 3:37335952-37335974 GGGGGTAATGGGAAAGTGGGTGG + Intronic
953616806 3:44497964-44497986 CAGTGTAATGGGAGGGAGACGGG + Intergenic
956729818 3:72186400-72186422 CACTGTGATGGGAAAGAGTGAGG + Intergenic
956864580 3:73356636-73356658 CAGGGAAATGGGAAAGCAGGAGG - Intergenic
957700488 3:83704399-83704421 GTGTTTAAAGGGAAAGAGGGTGG - Intergenic
957825886 3:85443412-85443434 CAGAGAAATGGGAATGAGGCTGG - Intronic
957954173 3:87162110-87162132 AAGTATAATGGAAGAGAGGGAGG - Intergenic
958684341 3:97373668-97373690 CAGTGTGATTTGAAAGAGAGAGG + Intronic
959311695 3:104745955-104745977 GAGAGTAATGGGAAGGAAGGGGG + Intergenic
959445884 3:106438940-106438962 CATTGTCTTGGGAAAGATGGTGG + Intergenic
962269228 3:133965959-133965981 GAGTGACATGGGAGAGAGGGAGG + Intronic
963073243 3:141322426-141322448 CAGTCTAATGGGAAAAATGCAGG - Intergenic
964270987 3:154956659-154956681 CAGTGAAGTGGGGAAGTGGGTGG + Intergenic
964321321 3:155500715-155500737 CAGAGTACTGGCAAGGAGGGTGG - Exonic
964587137 3:158318629-158318651 CAGTGTTATGGGACAGAGGATGG - Intronic
965079692 3:164020632-164020654 CAGTGCTATGGGTAAAAGGGAGG + Intergenic
967375232 3:188793476-188793498 CAGTATAATGAGAAAGTGGCCGG - Intronic
967483827 3:190006856-190006878 CAGAGTAATGGGAAACAAGGTGG + Intronic
967854593 3:194107119-194107141 CACTGTATTGGGAGAGGGGGTGG - Intergenic
968985857 4:3873916-3873938 CAGGGAAAGGGGAGAGAGGGAGG + Intergenic
969616049 4:8253132-8253154 CAGGGAAAGGGGAAAGAAGGAGG - Intergenic
970470513 4:16374068-16374090 CCCTGTAAAAGGAAAGAGGGAGG + Intergenic
970672688 4:18414668-18414690 CAATGAAAGGGGGAAGAGGGAGG + Intergenic
970956362 4:21816564-21816586 CTGTGTACTGGGAGAAAGGGAGG - Intronic
972165632 4:36280790-36280812 CAGTGGGATTGGAGAGAGGGAGG + Intergenic
973209424 4:47599272-47599294 AGTTGTCATGGGAAAGAGGGAGG - Intronic
973590698 4:52437604-52437626 CAGTGGGATAGGAAAGTGGGAGG + Intergenic
973838647 4:54837920-54837942 CAATGTAATGTGAAAGAAAGAGG - Intergenic
976582842 4:86759630-86759652 CAGTGCAGTGGGAAACAGGGAGG + Intronic
977352492 4:95906023-95906045 CATTGTAGTGGGAAAGATAGAGG + Intergenic
978228078 4:106362973-106362995 CAATTTAGTGGGAAAGATGGGGG - Intergenic
978629906 4:110732362-110732384 CAGTGTAGTGGGAAAGGTGTAGG + Intergenic
978840309 4:113204714-113204736 CAGTTTAGTGGGAAAGACTGAGG - Intronic
979371430 4:119892560-119892582 TAGTGGAATGGGAAAGGGGTAGG - Intergenic
979429527 4:120611858-120611880 CAGTGTAATGGGAACCATGGTGG - Intergenic
980228893 4:130022398-130022420 AAGTCTAATAGGAAAGAGGGAGG - Intergenic
981402429 4:144329067-144329089 AGGTGTAATGGGAAAAAGGCAGG + Intergenic
981955606 4:150469714-150469736 TAGAGAAATGGGAAAGAGTGAGG - Intronic
982783569 4:159516526-159516548 CAGTCTCATGGGAAGGAGGAAGG + Intergenic
986369124 5:7062739-7062761 CAGGCTAAGGGGGAAGAGGGAGG + Intergenic
986628703 5:9747990-9748012 CACTGTAATGGGATGGAGTGAGG + Intergenic
988163567 5:27552385-27552407 CATTGAAAGTGGAAAGAGGGGGG - Intergenic
991035090 5:62121032-62121054 CTGTGTAATGAGAAAGACCGAGG - Intergenic
992039912 5:72819501-72819523 TATTGAAATGGGAAATAGGGAGG + Intronic
993867143 5:93209249-93209271 CAGTGTCATGTGTAAGAGAGGGG + Intergenic
995242185 5:109898089-109898111 CTGAGAGATGGGAAAGAGGGAGG + Intergenic
995443050 5:112212856-112212878 CAGTCTAAAGAGAATGAGGGTGG - Intronic
995552228 5:113293207-113293229 CCTGGTGATGGGAAAGAGGGGGG - Intronic
995811664 5:116114289-116114311 CAGTGTACTGGGCAAGTGAGTGG + Intronic
997157089 5:131572745-131572767 CAGGCTAAGGGGGAAGAGGGAGG - Intronic
999087659 5:148907374-148907396 CAGAGTAATGTGATAGAGAGTGG + Intergenic
999325125 5:150639095-150639117 CAGTAGAATGGGCAAGAGAGAGG + Intronic
999479235 5:151930367-151930389 CAGTGTCATTGGAAGGAAGGAGG + Intergenic
999704843 5:154262751-154262773 CAGTGCAATGGGCAAGAGAAGGG + Intronic
1000925413 5:167187800-167187822 CTTTATAATGGGAAGGAGGGTGG - Intergenic
1003011884 6:2434251-2434273 CTGTGTCATGGGAATGAGGAAGG + Intergenic
1003228488 6:4227878-4227900 AAGGGTAGTGGGAAGGAGGGAGG + Intergenic
1003971858 6:11307819-11307841 CACCTTAATGGGAAAGAGAGGGG - Intronic
1004954241 6:20709827-20709849 GTATGTAATGGGAAAGAGGCTGG + Intronic
1005473778 6:26187617-26187639 AGGTGTAAAGGGAAAGAAGGTGG + Intergenic
1006349756 6:33512496-33512518 CAGTGTTATGGGCTAGGGGGAGG + Intergenic
1006424959 6:33958174-33958196 CAAAGAAATGGGGAAGAGGGGGG + Intergenic
1006446045 6:34080279-34080301 CAGTGTAAGTGGACAGAGAGGGG - Intronic
1007142512 6:39590059-39590081 CAGTGTAATTGGAAAGGAGGTGG + Intronic
1007207183 6:40162466-40162488 CAGTGTAATGTGATAGTGGTTGG - Intergenic
1007316550 6:40993854-40993876 CAGGGTACTGGGAAGGATGGAGG - Intergenic
1007359070 6:41342459-41342481 GGGTGGAATGGGAAAGAGGGAGG - Intronic
1007905812 6:45459775-45459797 CAGGGTAAGGGGACAGAGGGAGG + Intronic
1008125476 6:47663623-47663645 CAGTGTAAGGGGAGAGCAGGAGG + Intronic
1008574527 6:52847315-52847337 CACTGTAAGGGAAAACAGGGTGG + Intronic
1009964285 6:70562485-70562507 CAGTATAATAGGAAAGAAGCTGG + Intergenic
1010148995 6:72708358-72708380 ATGTGAAATGGAAAAGAGGGTGG + Intronic
1010224438 6:73475943-73475965 TTGTGTAATGGGCAAGGGGGCGG - Intronic
1011734572 6:90297531-90297553 CAGTGTTTTTGGAAAGAGAGTGG + Intergenic
1013532273 6:111030815-111030837 CAGTGTTGTGGGAAGGAGTGTGG + Intergenic
1013850864 6:114513749-114513771 AAGTGCAATTGGAAAGAGGTGGG + Intergenic
1014087429 6:117363543-117363565 CAATGTGATTGGAATGAGGGAGG - Intronic
1015316647 6:131824389-131824411 GAGTGTAATGGGGATGAGGTGGG + Intronic
1015517580 6:134099325-134099347 GAGTGTAATGGGATGGAGTGAGG - Intergenic
1015540578 6:134309573-134309595 CTCTGTAATGGGAAAGCAGGTGG - Intronic
1015544784 6:134350657-134350679 GAGTGAAATGAGAAAAAGGGAGG + Intergenic
1015686664 6:135870829-135870851 CAATGTAAAGAGGAAGAGGGTGG + Intronic
1015788841 6:136945953-136945975 CAGTGAAATGAGAACGTGGGTGG - Intergenic
1015935345 6:138402831-138402853 AAGAGAAATGGGAAGGAGGGTGG - Intergenic
1016389220 6:143558393-143558415 CATAGTAACGGGAAAGAGGTAGG - Intronic
1017389082 6:153918862-153918884 CATTCTAATTAGAAAGAGGGGGG - Intergenic
1017639043 6:156472448-156472470 CAGTGTAATGATAAAGAGCATGG - Intergenic
1018722909 6:166587265-166587287 CACTGGCATGGGACAGAGGGAGG + Intronic
1019015496 6:168877015-168877037 CAGTGCAAGAGGACAGAGGGAGG + Intergenic
1020464439 7:8461219-8461241 CCATGTAATGTGACAGAGGGAGG - Intronic
1020787491 7:12589917-12589939 CAGTGCTATGGGCAAAAGGGAGG + Intronic
1022667152 7:32422109-32422131 CACTGTAATGGGCAAGTGTGGGG - Intergenic
1022825991 7:34014458-34014480 CATTGAAATGGGACACAGGGTGG - Intronic
1023121800 7:36916715-36916737 CAGTGTAAGAGGAATGAGGGTGG - Intronic
1023350073 7:39311374-39311396 CAGTGTGATGGGCAAGACTGTGG - Intronic
1023362949 7:39434220-39434242 CAGGGAAATGGGAAAGAGGATGG + Intronic
1023759413 7:43450073-43450095 CACAGAAATGGGAAAGAAGGAGG - Intronic
1024904893 7:54366030-54366052 CAGTGTAAAAGGAAAAAGAGAGG - Intergenic
1027195166 7:76025082-76025104 AAGTGTACTGGGAATGAGGCTGG + Intronic
1028427482 7:90706565-90706587 CAGTGTAATGTGATAGGGGAGGG + Intronic
1029371375 7:100153197-100153219 CAGTATTATGGGAAACAGGATGG + Intronic
1030193277 7:106830609-106830631 CAGGCTAAGGGGGAAGAGGGAGG - Intergenic
1031160531 7:118162059-118162081 CAGTCTTAGAGGAAAGAGGGAGG + Intergenic
1032189031 7:129752265-129752287 CAGTGTAAAAGGAAGGAGTGGGG + Intronic
1032263452 7:130354275-130354297 GAGTGAAATGGGAAAGAAAGAGG - Intronic
1033334261 7:140438931-140438953 CAGCGTTATGGGAAAAAGTGAGG - Intergenic
1033425379 7:141239288-141239310 GAGTGCCATGGGAGAGAGGGAGG + Intronic
1034165518 7:149022206-149022228 AAGTGTGAAGGGGAAGAGGGCGG + Intronic
1034445575 7:151112464-151112486 CAGTAGGATGGGAAAGAAGGGGG - Intronic
1036908592 8:12731453-12731475 CAGTGGAATGGGAAATAGAGAGG - Intronic
1037530959 8:19773001-19773023 CAGGGAGATGAGAAAGAGGGTGG + Intergenic
1037723714 8:21466348-21466370 CAGTGTAATGGGGGGAAGGGTGG + Intergenic
1039617751 8:38969791-38969813 CAGTGCCATGGGAGGGAGGGAGG + Exonic
1041304554 8:56446349-56446371 AAATGTGAAGGGAAAGAGGGCGG + Intronic
1041334910 8:56771204-56771226 TAGTATAGTGGGAAAGAGGATGG + Intergenic
1041690832 8:60685289-60685311 CAGTGAAATGGGAGAGGGGAGGG + Intronic
1042292084 8:67179343-67179365 CAGTGTCATGGGAGAGAGAGGGG - Intronic
1043085393 8:75825893-75825915 CAGTGTAATGGTAAATATGAGGG + Intergenic
1044642929 8:94404072-94404094 ATGTGTAATGGGAATGAGGTAGG - Exonic
1045270335 8:100655878-100655900 CAGTGTGCAGGGAATGAGGGGGG + Intronic
1045349979 8:101329758-101329780 CAGGGGAGTGGGAAGGAGGGAGG - Intergenic
1045998727 8:108394619-108394641 CAGTGTAATTGGAAATAGGAAGG - Intronic
1046705757 8:117449787-117449809 CAGACATATGGGAAAGAGGGAGG + Intergenic
1047684350 8:127289343-127289365 AAGTTTCATGGGAAAGAGGAAGG - Intergenic
1048456696 8:134584788-134584810 CGGGGGAAGGGGAAAGAGGGCGG + Intronic
1049070145 8:140349599-140349621 CAGTGGGGTGGGAGAGAGGGAGG + Intronic
1052178582 9:25496782-25496804 CAGCGTCATGGGACAGAGGAGGG + Intergenic
1053345785 9:37377346-37377368 CAGTGTCCTGGGATAGAGTGAGG + Intergenic
1054947346 9:70810125-70810147 CAGGGTGATGGAAAGGAGGGTGG - Intronic
1055769767 9:79704520-79704542 CAGAGAGATGGGACAGAGGGAGG - Intronic
1056303113 9:85262198-85262220 AAGAGAAATGGGAAAGAGGTGGG - Intergenic
1056493049 9:87126751-87126773 TACTGAAATGGGAAAGATGGGGG - Intergenic
1057973497 9:99579656-99579678 CAGAGTAATGGGACAGAGAGTGG + Intergenic
1058836139 9:108860003-108860025 GAGTGTATTAGCAAAGAGGGAGG + Intergenic
1059463082 9:114447551-114447573 CAGTCTAGTGAGGAAGAGGGAGG - Intronic
1059844115 9:118252463-118252485 TAGAGTAAGTGGAAAGAGGGAGG - Intergenic
1059847815 9:118301053-118301075 CAGTGTGTTGGAAAAGAGGATGG + Intergenic
1060044424 9:120328423-120328445 CAGTTTAGGGGCAAAGAGGGAGG - Intergenic
1061891933 9:133626537-133626559 CTGGGTAATGGGCAAGAGGTTGG - Intergenic
1185989429 X:4876462-4876484 CAGTGGAAAGAGGAAGAGGGTGG + Intergenic
1186799979 X:13083194-13083216 CTGTGAAATGGGAAAGAGGAAGG - Intergenic
1186950016 X:14614198-14614220 GAGAGTAATGGGAAAGATGGAGG + Intronic
1189223797 X:39395857-39395879 AACTGAATTGGGAAAGAGGGAGG + Intergenic
1189699844 X:43707130-43707152 CAGGGAAATGGGAAAGGGGTGGG + Intronic
1189777248 X:44481603-44481625 GAGTGTCAGGGGAAAGAGGAAGG + Intergenic
1189900363 X:45700173-45700195 CAGTGGATAAGGAAAGAGGGTGG + Intergenic
1190534417 X:51411520-51411542 CTGTGAACTGGGAAAGAGGTGGG + Intergenic
1192179824 X:68909437-68909459 CAGGGTAAAAGGAAAGAGAGTGG + Intergenic
1192191504 X:68994124-68994146 CAGTGTAACAGCAAAGAGGGAGG - Intergenic
1192264401 X:69529172-69529194 CAGGGCACTGGGGAAGAGGGAGG + Intronic
1192764805 X:74129616-74129638 CAGGCTAAGGGGGAAGAGGGAGG + Intergenic
1193813438 X:86078689-86078711 CAGTTTAATAGGAAATATGGCGG - Intergenic
1194482957 X:94449632-94449654 CAGTTCTATGGGATAGAGGGAGG - Intergenic
1194743208 X:97600358-97600380 AAGTGAAATTGGAAAGAGAGTGG - Exonic
1195604575 X:106790466-106790488 GAGTCTATTTGGAAAGAGGGAGG - Intronic
1195635771 X:107114193-107114215 CAGTGAAATTGGAGAGAGGTAGG - Intronic
1196512156 X:116524322-116524344 CAGTGGACTGGGAAGGTGGGTGG - Intergenic
1196634667 X:117988592-117988614 CAATCTAATGGGGAAGATGGGGG + Intronic
1197698488 X:129576709-129576731 AAGCCTAAGGGGAAAGAGGGGGG + Intronic
1199253039 X:145686490-145686512 TACTGTAATGAGAAAGAGGAAGG - Intergenic
1200007986 X:153100477-153100499 CAGGCTAAGGGGGAAGAGGGAGG + Intergenic
1200931424 Y:8700479-8700501 CAGTGAATTGGGAAACAGGCTGG - Intergenic
1201234399 Y:11895613-11895635 CAGGCTAAGGGCAAAGAGGGAGG + Intergenic
1201243997 Y:11985835-11985857 CAGTGAAGTGGGGATGAGGGAGG + Intergenic
1201702555 Y:16900472-16900494 GAGGGAAATGGGAAGGAGGGAGG - Intergenic