ID: 1079944330

View in Genome Browser
Species Human (GRCh38)
Location 11:26722817-26722839
Sequence ATGGAGAAGGCCACTGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 337
Summary {0: 1, 1: 0, 2: 1, 3: 39, 4: 296}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079944330 Original CRISPR ATGGAGAAGGCCACTGAAGA AGG (reversed) Intronic
900140784 1:1138816-1138838 AGGGAGAAGCTCTCTGAAGACGG + Intergenic
900919986 1:5663934-5663956 ATGGAGATGGAGACTGAAGAGGG + Intergenic
901227578 1:7623043-7623065 CTTGAGAAGGCCTCTGAGGATGG - Intronic
901424274 1:9171486-9171508 ACAGAGAAGGCCACTGAAAGAGG + Intergenic
902411349 1:16213198-16213220 GTGGAGGCGGCCACTGGAGATGG - Intergenic
902882646 1:19382937-19382959 AGAGAGAAGTCCAGTGAAGATGG - Intronic
903651407 1:24924595-24924617 ATGCAGAAGCCCACAGCAGAGGG - Intronic
903735977 1:25530171-25530193 ATGGCGCAGGCCCCTGGAGATGG - Intergenic
904558229 1:31379553-31379575 ATAGGGAAGGCCAGGGAAGATGG - Intergenic
904910349 1:33929937-33929959 ATGGGGAAGGCTACTTTAGACGG - Intronic
906173997 1:43753674-43753696 AGGGAGAAAGCCACTGACAAAGG - Intronic
907158961 1:52357703-52357725 AGGGAGAAGGCCACTGGTTAGGG + Intronic
907527288 1:55061307-55061329 ATGGGGATGGGCACTGGAGACGG + Intronic
907598114 1:55739071-55739093 ATAGAGAAGAGCACTGAATAAGG + Intergenic
907733877 1:57092960-57092982 ATTGAGAAGGCGATGGAAGAGGG + Intronic
908150344 1:61294847-61294869 ATACAGAAGTCCACTGAATACGG - Intronic
908312878 1:62903081-62903103 AGGGAGAAAGCAAATGAAGATGG - Intergenic
909500122 1:76325147-76325169 ATGGAGAAGACCATAGGAGAAGG + Intronic
910384209 1:86664234-86664256 AAGGAGAGGAGCACTGAAGAAGG + Intergenic
910628667 1:89335441-89335463 AAGGAAAAAGACACTGAAGAGGG + Intergenic
911525368 1:98978349-98978371 ATGGAGAAGAAGATTGAAGATGG - Intronic
912771577 1:112468960-112468982 ATACAGAAGACAACTGAAGATGG - Intronic
913338694 1:117734492-117734514 ATCCAGAAGGCAACTGATGAAGG + Intergenic
917397049 1:174604460-174604482 AAGGAAAAAGGCACTGAAGAGGG - Intronic
919499443 1:198317390-198317412 AGGGAGAAAGACACTGAATAAGG - Intronic
919825430 1:201500166-201500188 AAGGAGAAGGCCGAGGAAGAGGG - Intronic
920308700 1:205035285-205035307 AGGGATAAGGGCACTGCAGAGGG + Intergenic
920360479 1:205411946-205411968 ATGCAGCAGCCCTCTGAAGATGG + Intronic
921412475 1:214850513-214850535 ATGGAGGAGGGCAGAGAAGAAGG - Intergenic
921891670 1:220360026-220360048 ATGGAGCAGAGCACAGAAGATGG - Intergenic
924113897 1:240726908-240726930 ATGGAGAAGACTGCAGAAGAAGG + Intergenic
924145909 1:241074383-241074405 ATAGAGAAGGATACTGAAGAGGG + Intronic
1063532213 10:6844500-6844522 AAGCAGAAGGCCAGTGAAGAAGG + Intergenic
1064034327 10:11902894-11902916 CTGGAGCTGGCCACTGAAGAGGG - Intergenic
1065327565 10:24562689-24562711 ATGGGGAAAGGAACTGAAGATGG - Intergenic
1068384947 10:56314313-56314335 AGAGAGAATGCCACTGAAGATGG + Intergenic
1068678474 10:59793099-59793121 GTGGTGAAGGCCTCTGCAGAGGG + Exonic
1068724789 10:60289032-60289054 AAGGAGAAAGCCACTGAAGTAGG + Intronic
1070407610 10:76110986-76111008 ATGGAGAATGACACTTCAGAGGG - Intronic
1070953162 10:80446894-80446916 AGGGAGAAGGCAAGAGAAGAGGG - Intergenic
1071502045 10:86211100-86211122 ATGGAGCAGCCCTGTGAAGAGGG - Intronic
1072783725 10:98266985-98267007 AAGGAGAAGGGGACAGAAGAGGG + Intronic
1073618092 10:105018368-105018390 ATGGCCAAGGCCACTGCAGTTGG + Intronic
1074116299 10:110459717-110459739 GGGGAGAACGCCAGTGAAGATGG + Intergenic
1074967894 10:118508429-118508451 ATGGAAAAGGCCTTTGAAGGTGG - Intergenic
1076074751 10:127524304-127524326 TTGGACCAGGCCACTGAAGAGGG - Intergenic
1077721860 11:4637853-4637875 ATGAAGAAGGAAACTGAAGCTGG + Intergenic
1077754511 11:5011873-5011895 GTTAAGAAAGCCACTGAAGATGG - Intergenic
1078067932 11:8090117-8090139 ATGGTGCAGGCCAATGCAGATGG + Exonic
1078550272 11:12275498-12275520 AAGGAGATAGCCAGTGAAGAAGG + Intergenic
1079944330 11:26722817-26722839 ATGGAGAAGGCCACTGAAGAAGG - Intronic
1079981305 11:27154094-27154116 CTGGAGAAGGCCCATGAAGGGGG - Intergenic
1080215650 11:29836981-29837003 ATGGTGATGGCGACTGATGATGG - Intergenic
1080644768 11:34180511-34180533 ATGGACAAAGCCACTTAAAAAGG + Intronic
1082067919 11:47915749-47915771 ATGGAGAAGGCCACCTGACAAGG - Intergenic
1082895345 11:58184151-58184173 ATGGCTAAGGCCAAGGAAGATGG + Intergenic
1083659041 11:64243719-64243741 ATGGAGAAGGGTAATGGAGATGG - Intronic
1084472853 11:69373322-69373344 ATGGAGGAGGCAAGAGAAGAAGG + Intergenic
1084629262 11:70335415-70335437 ATGCAAAAGTCCACTCAAGATGG + Intronic
1085556886 11:77431469-77431491 GAGGAAAAGACCACTGAAGAGGG - Intronic
1085735867 11:79038504-79038526 AGAAAGAAGGCCAGTGAAGAGGG - Intronic
1086439451 11:86813728-86813750 ATGGAGAAGGAGACTTATGAAGG + Intronic
1086942201 11:92809899-92809921 ATGGCCAAGGCCACTGACGGGGG + Exonic
1087564836 11:99841652-99841674 AAGGAGAAGGAGAATGAAGAAGG + Intronic
1089056000 11:115585371-115585393 AGTGGGAAGGCCAGTGAAGAAGG + Intergenic
1089076879 11:115745506-115745528 AGGGAGAAAGGCACTGGAGAGGG - Intergenic
1090126245 11:124088077-124088099 TGGGAGATGGGCACTGAAGAGGG - Intergenic
1091453263 12:586826-586848 AAGGTGAAGGTCACTGCAGAGGG - Intronic
1092105692 12:5920381-5920403 ATGGAGAAGGCCACTAGATGTGG + Intronic
1093854828 12:24088870-24088892 ATTCAGAAGGCCAGTGAAGAAGG - Intergenic
1097203380 12:57299125-57299147 ATGGATAATGCCAATGCAGATGG + Intronic
1097247044 12:57612413-57612435 ATAGAGGAGGCCAGTGAGGAGGG - Intronic
1097354720 12:58588223-58588245 ATGGAGAAGGTCACAGAGCACGG + Intronic
1098080758 12:66782849-66782871 ACAGAGAAGGAAACTGAAGATGG + Intronic
1099598710 12:84703044-84703066 ATGTGGAAGGCCACTGAAATGGG + Intergenic
1102112596 12:110376025-110376047 TGGGGGAAGGCCACTGAGGAGGG - Intronic
1103476010 12:121219214-121219236 AAGGAGAAGGCCACAGGAGGAGG - Intronic
1104498893 12:129266092-129266114 CTTGTGAAGGCCACTGATGATGG + Intronic
1105284704 13:18994574-18994596 ATGCAGAAGGCCAGGGAAGAAGG + Intergenic
1105674897 13:22660572-22660594 ACAGAGAAGACCACTGGAGACGG + Intergenic
1106413630 13:29528050-29528072 ATGGAGAAGGGAACAGCAGAGGG - Intronic
1107194299 13:37629569-37629591 GTGGAGGAAGTCACTGAAGATGG + Intergenic
1107658240 13:42613658-42613680 ATGGAGCAGGCTACAGAAGCAGG + Intergenic
1109220461 13:59636190-59636212 AAGGAAAAGGGTACTGAAGATGG + Intergenic
1110872991 13:80474468-80474490 ATGGAGAAGGTCATTTTAGAAGG + Intergenic
1112691813 13:101905004-101905026 TTGGAGTAAGCCACTAAAGAGGG - Intronic
1113842836 13:113370075-113370097 TCCGAGAAGGCCTCTGAAGAAGG + Intergenic
1114182803 14:20380000-20380022 GTGGAGAAGGCCACAGCAGTAGG + Exonic
1116114845 14:40635085-40635107 AAGAAAAAGGTCACTGAAGAGGG + Intergenic
1116761692 14:49022758-49022780 AAGGACAAGGCAACTGAGGAAGG - Intergenic
1117102083 14:52360098-52360120 ATGGAAAAGGAAACTGAAAATGG + Intergenic
1117263204 14:54058094-54058116 CTGGAGCAGGCCACTGGAGCTGG - Intergenic
1117460375 14:55939295-55939317 ATGGACCAGACCACAGAAGAGGG + Intergenic
1118487093 14:66224549-66224571 AGAGAGAAGGGCACTGGAGAAGG + Intergenic
1118574732 14:67230997-67231019 ATCGAGAAGGCTACTGACTAAGG - Intergenic
1119042264 14:71285654-71285676 AAGGAGAAGGTGATTGAAGATGG - Intergenic
1119666002 14:76485591-76485613 ATGGAAAATGCATCTGAAGATGG + Intronic
1120625679 14:86823129-86823151 ATTGAGAAAGACACTGAAAATGG - Intergenic
1120898436 14:89555392-89555414 ATGGAGAAGACTACTGTTGAGGG - Intronic
1121705050 14:95986116-95986138 ATCCAGAAGACCACTGATGAAGG - Intergenic
1122248717 14:100423301-100423323 GTGGAGAATGCCACTGAGGATGG + Intronic
1122983194 14:105200691-105200713 ATGGAGAAGGGCCCAGAGGATGG - Intergenic
1123952940 15:25301156-25301178 ATTGAGAAGGCAACTTAAAAAGG + Intergenic
1124033669 15:26033784-26033806 ATGGGGAAGGACACACAAGAAGG - Intergenic
1124859726 15:33427150-33427172 ATGCAGAAAGGCACTGAACAGGG + Intronic
1126114925 15:45199605-45199627 ATGGGGAACGACACTGAAGGAGG - Intronic
1127231593 15:57001840-57001862 AAGGAGAAAGCCACAGGAGAAGG + Intronic
1132594549 16:742441-742463 ATGGAGAAGGCCACACAGGCTGG - Intronic
1133667121 16:7979476-7979498 AGGCAGGAGGCCAGTGAAGAAGG - Intergenic
1133697501 16:8278824-8278846 ACGGAGAAATCCACTGAAGAGGG - Intergenic
1133950744 16:10390197-10390219 ATGGAGAAACCCAATGAAGCAGG + Intronic
1134117569 16:11560765-11560787 GTAGAGAAGGCCACAGAAGCAGG + Intronic
1134413649 16:14024469-14024491 ATTGATATGGCCACTGCAGAGGG + Intergenic
1135757693 16:25111780-25111802 AGGGAGAAAGCAACAGAAGAGGG - Exonic
1136014743 16:27388968-27388990 AAGGAGAAGGCCACTGCTGTTGG - Intergenic
1137372694 16:47923178-47923200 ATGTAGAAGGCACCTGGAGAAGG + Intergenic
1138934890 16:61706677-61706699 ATGTATAAGGGCACAGAAGACGG + Intronic
1138961256 16:62033137-62033159 ATGGAGAAGACCACTTGAGAAGG - Intronic
1141399162 16:83732249-83732271 CTGGAGAAGGCCACCTTAGATGG + Intronic
1141733758 16:85839221-85839243 ATGGAGGAGGTCCCAGAAGAGGG + Intergenic
1142314347 16:89334250-89334272 ATTGTGAAGGCCATTGATGAGGG - Intronic
1142352221 16:89585759-89585781 ATGCAGAAGGCCTTTGAGGAGGG + Exonic
1142493089 17:291080-291102 GTGGAGATGAACACTGAAGATGG + Intronic
1142930719 17:3282022-3282044 ATGGAGAAAAACAATGAAGAGGG - Intergenic
1143008261 17:3851290-3851312 ATGGAGAAGGTGAGGGAAGATGG - Intergenic
1144234237 17:13241736-13241758 CTGAAGAAGGCCAGTGTAGATGG + Intergenic
1146370708 17:32264347-32264369 AAGGAGAAGGGCACAGAAAAGGG - Intergenic
1146475202 17:33157136-33157158 AGGGAGAGGGACACTGAGGAGGG - Intronic
1147171340 17:38620852-38620874 ATGGACAAGGCCACTGTAGGTGG - Intergenic
1148496944 17:48058679-48058701 ATGGACCTGGCCATTGAAGAAGG + Exonic
1150180364 17:63112897-63112919 CTGGGGAAGGTCACAGAAGAAGG - Intronic
1150647620 17:66989353-66989375 ACGGAGAAGGACACAGAAGATGG + Intronic
1151001237 17:70379386-70379408 ATGGTGAAGGTCATTGAGGATGG + Intergenic
1151570847 17:74924612-74924634 ATGGCGGAGGCGACTGGAGAAGG - Exonic
1152274140 17:79344475-79344497 ATTGAGAAGCCCAATGAGGAAGG - Intronic
1152317536 17:79589692-79589714 CTGGAGAACGGCAGTGAAGAGGG + Intergenic
1153451376 18:5233286-5233308 ATGGACCAGGCAACTGAGGATGG + Intergenic
1154371847 18:13770720-13770742 ATGCAAAAATCCACTGAAGATGG + Intergenic
1156540279 18:37903036-37903058 GTGGAGAAGGGCAGTGATGATGG + Intergenic
1157456263 18:47831311-47831333 ATGGAGAAGACCTTTGAAGAAGG - Exonic
1157633842 18:49129684-49129706 ATGGAGCAGGCGACTGAAGAGGG + Intronic
1157880121 18:51313514-51313536 AGGGACAAGGCTAGTGAAGAAGG - Intergenic
1158280413 18:55819393-55819415 ATGGAGAAGGAGACCAAAGAGGG + Intergenic
1159985948 18:74841104-74841126 ATAGTAAAGGGCACTGAAGAGGG - Intronic
1163131908 19:15279433-15279455 ATGGAGGATACCAGTGAAGAGGG - Intronic
1164910049 19:32002705-32002727 ATGGAGAAGGCCACGTGACAGGG - Intergenic
1164914954 19:32045048-32045070 ATGGAGAAGGCAGGTAAAGAGGG + Intergenic
1165733417 19:38160814-38160836 AGAGGGAAGGCCACTGTAGAGGG + Intronic
1166353101 19:42209963-42209985 TTAGACAGGGCCACTGAAGAAGG - Intronic
1166764745 19:45245835-45245857 ATGGAGGAGGGCACTGGACATGG + Intronic
1166996699 19:46722917-46722939 CTGGTGAAGGCCACTGAGGTGGG + Exonic
1167033083 19:46976590-46976612 ATGGAGAAGGCGAGTGCAGCCGG - Intronic
925054119 2:842737-842759 TTTGAGAAGGCCACTGTAGCAGG - Intergenic
925613046 2:5719127-5719149 AAGAAGAAGGACAGTGAAGAAGG + Intergenic
926350257 2:11987515-11987537 ATGGAAAAGGCCACTGGACATGG - Intergenic
928566568 2:32557451-32557473 ATGAATATGGACACTGAAGATGG - Intronic
934036474 2:88092606-88092628 ATTGAGAAAGTCACTCAAGATGG + Intronic
936904230 2:117518204-117518226 ATGGAGAATGCTACTGCTGATGG + Intergenic
937006395 2:118520469-118520491 ATGCAGAAGGCAGCTGCAGATGG - Intergenic
938279150 2:130052216-130052238 ATGGAGAAAGCCAGGGAACAGGG - Intergenic
940491021 2:154360926-154360948 ATGGGGAAGGGGAGTGAAGATGG + Intronic
940897096 2:159091140-159091162 TTGGAGAAGGCTACTGAGAAAGG - Intronic
942191812 2:173477945-173477967 AGGGAGAAAGCCACTGATCAGGG - Intergenic
942572536 2:177328428-177328450 ATGGAGAAGGTAATTGGAGATGG + Intronic
943237349 2:185338959-185338981 AAGGAAAAAGGCACTGAAGATGG - Intergenic
943339962 2:186668803-186668825 ATTTGTAAGGCCACTGAAGATGG - Exonic
944665641 2:201956718-201956740 GTGGAGAAGGGCACAGAAGAGGG - Intergenic
944855221 2:203760620-203760642 AAGGAAAGGGACACTGAAGAAGG - Intergenic
944985299 2:205169363-205169385 ATGCAGAATGACACTGAAGTAGG - Intronic
945542467 2:211105611-211105633 ATAGAGCAGGCCACTGAGCAAGG - Intergenic
947462161 2:230313057-230313079 ATGGAGGTGGCCACGGAAGTGGG - Exonic
948192890 2:236073797-236073819 GTTGAGAAGGCCACGGGAGACGG - Intronic
948477174 2:238227631-238227653 GTGGAGAAGGCCGCTGGAAAGGG - Intronic
948565678 2:238884669-238884691 ATGGAGAAGGGCTCAGATGAAGG + Intronic
948611494 2:239169990-239170012 AGGTAGAAGGCCTCTGAGGAGGG - Intronic
1169004706 20:2196892-2196914 ATGGAGAAGGGCATGGAGGAGGG + Intergenic
1170302982 20:14906919-14906941 ATTGAAAAGTCCACAGAAGAAGG + Intronic
1171307132 20:24116339-24116361 ATGGGGCAGCCCACTGCAGAGGG + Intergenic
1171781548 20:29423241-29423263 CTGGATGAGGCCATTGAAGAGGG - Intergenic
1173785986 20:45792945-45792967 ATGGGGAAGGGCACAGGAGATGG + Intronic
1176049674 20:63111349-63111371 TTTGTGAAGGCCACTGAGGATGG - Intergenic
1177824867 21:26071343-26071365 CTGGAGAGGGAAACTGAAGATGG - Intronic
1178306828 21:31498119-31498141 AGGGAGGCTGCCACTGAAGAGGG - Intronic
1178862503 21:36300907-36300929 ATGGACAAGCCTAGTGAAGACGG - Intergenic
1179711470 21:43265901-43265923 GAGGAGAAAGCCACTGCAGACGG - Intergenic
1179900219 21:44388468-44388490 ATGGAGAAGGACAGTGATGATGG + Intronic
1183597360 22:38820727-38820749 AGGGGGAAGAACACTGAAGAGGG + Exonic
1183898502 22:40988082-40988104 AAGGAGCTGGCCAGTGAAGACGG - Intergenic
1184015665 22:41784093-41784115 ATGGAGGAGGCCAGTGAGGATGG + Intronic
1184281660 22:43440896-43440918 ATGGAAAAGGGCCCTGGAGAGGG - Intronic
1184348689 22:43928849-43928871 AGGGATAAGGCCACTGTAGAAGG - Exonic
949099684 3:128972-128994 ATTGAGAAGGCCTCAGAGGAAGG - Intergenic
949841112 3:8321033-8321055 ATACAGTAGGACACTGAAGATGG - Intergenic
949862108 3:8515365-8515387 ATGGAGGAGGGCACTGAGGAAGG - Intronic
951613731 3:24520430-24520452 ATGGAGAAGGGCACTTAAAATGG - Intergenic
951617643 3:24566334-24566356 AGCAAGAAGGCCAATGAAGATGG - Intergenic
951876505 3:27431695-27431717 ATGATGAAGTCCACTGCAGAAGG + Intronic
952327239 3:32332485-32332507 TTGGAGAAGGGCACAGAAGGAGG + Intronic
953014193 3:39057034-39057056 GTGGAGAAAACCATTGAAGAAGG + Intronic
953957005 3:47239441-47239463 CTGGAGAAGGCCAGTGATGGTGG - Intronic
955103978 3:55878355-55878377 TTGGAGAAGGCCTTTGAAGTTGG - Intronic
955342865 3:58138891-58138913 ATGGAGAATGGCCATGAAGATGG - Intronic
955838232 3:63082031-63082053 ATGGAAAAGGTCACTGTAAATGG + Intergenic
957261392 3:77906519-77906541 ATGGAGAAGGAGGCTGAAGAAGG + Intergenic
959166544 3:102786816-102786838 ATGGAGAATAGCACTGGAGAGGG - Intergenic
960106540 3:113803946-113803968 ATGAAGAAGGCTTCTGAAGGAGG - Intronic
960374784 3:116886200-116886222 ATAATGAAGGCCAATGAAGAGGG - Intronic
960673319 3:120172301-120172323 ATGGAGAAGGGGACTAAACAAGG - Intronic
963117124 3:141739506-141739528 ATAAAGAATTCCACTGAAGAGGG - Intronic
963940480 3:151091683-151091705 ATGGAAAAAGCCACTGGAGGGGG - Intronic
964312556 3:155410305-155410327 GTGTAGAAGGCCACTGAGCAGGG - Intronic
964517676 3:157530572-157530594 ATGGAGATGGTCACTCAAGAAGG + Intronic
964828821 3:160860384-160860406 ATGAAGAAGGCAACTGAATGTGG + Intronic
965680291 3:171243762-171243784 TTGGAGAAAGCCTCTGAAAATGG - Intronic
966679362 3:182625084-182625106 ATGAAGAAGGGCACAGAAGTGGG + Intergenic
969156607 4:5216608-5216630 ATGGATGAGGACACTGCAGAGGG + Intronic
969637053 4:8375334-8375356 ATGGAAGAGGCCTATGAAGATGG + Intronic
970290365 4:14564768-14564790 AGGGAGAACAGCACTGAAGATGG - Intergenic
970700614 4:18733513-18733535 ATGGACAAGGCTTCTAAAGAAGG + Intergenic
973324090 4:48839881-48839903 GTGGAAAAGGCCACTGACTAGGG + Intronic
976129014 4:81864627-81864649 ATGGAGAAAGCCAATTAAAAGGG + Intronic
976674129 4:87685643-87685665 ATGGAGGAGGCCAGTGAGGCTGG - Intergenic
978126326 4:105140122-105140144 ATGGAGAAGGCAAATTAAAAAGG - Intergenic
978413927 4:108455604-108455626 ATGGTTAAAGCCAGTGAAGAGGG - Intergenic
978839458 4:113192881-113192903 ATAGAGAATGACACTGAATATGG - Intronic
981659072 4:147145300-147145322 GAGGAGAAGGCCATTGAAGTTGG + Intergenic
981836709 4:149063833-149063855 AAGGAAAGGGGCACTGAAGAAGG + Intergenic
982099129 4:151951465-151951487 ATGGACAAGGCAAGTGAACATGG - Intergenic
983483554 4:168305840-168305862 ATGGAGAAGGTCAATAAAGAAGG - Intronic
983658055 4:170102507-170102529 ATGGTGATGGCCACAGGAGAGGG - Intergenic
984252595 4:177352317-177352339 CTGCTGAAGGACACTGAAGAGGG - Intronic
984951271 4:185009490-185009512 AGGGAGAAGGCAAGTGAGGATGG + Intergenic
985681839 5:1259714-1259736 ATGCAGATGCCCACAGAAGAGGG + Intronic
986302989 5:6493189-6493211 ATGGAGAATGCCACCATAGAGGG - Exonic
987304057 5:16621431-16621453 ATGGATAAAGACCCTGAAGAAGG + Intergenic
988241013 5:28609364-28609386 CTGGAGAAGGCCTCTAATGATGG + Intergenic
989734731 5:44690088-44690110 TAGGAGAAGGCTACTGAATATGG + Intergenic
993919445 5:93782136-93782158 TTGGAGAAGATCACTGAATAGGG + Intronic
994952619 5:106483769-106483791 AAGGAGAAAGCCAAGGAAGAAGG + Intergenic
996039669 5:118795824-118795846 AGGGAGAAAGCCCATGAAGAAGG + Intergenic
996857053 5:128020000-128020022 ATTGAGAATAACACTGAAGATGG - Intergenic
997159241 5:131589784-131589806 ATGCAGATGGCCCCTGAAGCTGG - Intronic
998039556 5:138943825-138943847 GTGGGGAAGGCCTCTGAGGAGGG - Intergenic
998775239 5:145592316-145592338 AAGGAGAATGACACTGAGGAAGG + Intronic
998879687 5:146633514-146633536 AGGGAGATGTGCACTGAAGAAGG + Intronic
1001669483 5:173461815-173461837 AGGGTGAAAGCCAGTGAAGAAGG - Intergenic
1002588940 5:180274475-180274497 ATGGAGGAGGTCACTTGAGAAGG + Intronic
1002658795 5:180775823-180775845 ATGGAGAATGCCATTGATGCTGG - Intergenic
1002770257 6:284254-284276 ATGGAGGAGGAGACTTAAGAGGG + Intergenic
1003194344 6:3901848-3901870 TTGGAGAAAGCCAGTGAACAGGG + Intergenic
1004998677 6:21218654-21218676 ATGCAGAAGTCCACAGGAGAAGG - Intronic
1005157204 6:22820152-22820174 ATGGAGAAAGGCATTAAAGAGGG - Intergenic
1005279872 6:24262065-24262087 AAGGAGAAAGGCACTGAAGATGG + Intronic
1005929074 6:30467411-30467433 GAGGAGAAGGCCAAGGAAGAGGG + Intergenic
1006069841 6:31490468-31490490 GAGGAGAAGTCCTCTGAAGAAGG + Intergenic
1006574194 6:35031926-35031948 ATGGAGAAAGCCACCCAAGTAGG - Intronic
1006829929 6:36962360-36962382 CTGGAGAAGTCCCCTGAAAAAGG + Intronic
1007041055 6:38722810-38722832 ATGGAGAAGGATGCTGAAGATGG + Exonic
1007077425 6:39076779-39076801 ATGGAGACAGCCAGTGCAGAAGG + Intronic
1007081098 6:39104852-39104874 ATGGTGATGGGCAATGAAGAGGG + Exonic
1007125831 6:39424867-39424889 ATGGTCAAGGACACTCAAGATGG + Intronic
1008101179 6:47392782-47392804 AAGGAGCTGGGCACTGAAGAGGG - Intergenic
1011765585 6:90616045-90616067 GTGAACAAGGCCTCTGAAGATGG + Intergenic
1011836182 6:91434067-91434089 AAGGAGAGGGCCAGTGGAGAAGG - Intergenic
1011882334 6:92045281-92045303 ATGGTAAAGGTCACTGAACAAGG - Intergenic
1011998906 6:93629034-93629056 ATGGAGAAGGCCACATGAAAGGG + Intergenic
1014222284 6:118809757-118809779 ATGGACAAGACCGCTGAAGACGG + Intergenic
1014694215 6:124598610-124598632 ATGGGGAAAGCCACCGAGGAGGG + Intronic
1015134959 6:129858346-129858368 ATGGAGAAGGCTATTACAGAAGG - Intronic
1016422750 6:143901763-143901785 CTGGAAAAGGCTACTGGAGAAGG - Intronic
1016894444 6:149038403-149038425 AGGATGAAGGCCAGTGAAGATGG + Intronic
1018190801 6:161307740-161307762 TTGCAGAAGGCCATGGAAGATGG - Intergenic
1018248336 6:161843297-161843319 ATGGAGAAGGAGACAGAAGGTGG - Intronic
1018577680 6:165276643-165276665 AGGGACAAGGACAATGAAGAGGG - Intergenic
1019456420 7:1130107-1130129 ATGGAGCAGGCCACGTATGAGGG + Intronic
1019611704 7:1940055-1940077 ATGGAAGAGGCCAGTGGAGATGG + Intronic
1020712670 7:11628405-11628427 ATGGAGATGGCCAAAGAATATGG - Intronic
1021239926 7:18187850-18187872 AGGAAGAAGCACACTGAAGAAGG - Intronic
1021545179 7:21804971-21804993 AGACAGAAGGCCAGTGAAGATGG - Intronic
1023088590 7:36597013-36597035 AAGGAGGAGGCAATTGAAGAAGG - Intronic
1023650257 7:42362010-42362032 AAGGAGAAGCTCACTGAAGGTGG - Intergenic
1026989454 7:74575369-74575391 ATGGAGATGGACAGGGAAGATGG + Intronic
1027799389 7:82732938-82732960 ATGGCCAAGGCCACTGTAGCTGG - Intergenic
1028474048 7:91234469-91234491 ATGGAGAAGGCGTCTGCAGAAGG - Intergenic
1028752066 7:94393640-94393662 ATGGAGGCGGCCAGAGAAGAGGG + Intergenic
1028940026 7:96511429-96511451 ATGGAGATGGACACTGAACGAGG + Intronic
1029175799 7:98663530-98663552 ATGGAGAAGGACAGGGAAGGTGG + Intergenic
1029961475 7:104692784-104692806 ATGGAGAAGGAAATTGCAGAAGG + Intronic
1031753654 7:125611345-125611367 AGGGAAAAAGGCACTGAAGAGGG + Intergenic
1033444601 7:141409233-141409255 ATGGGCAATGCCACTGCAGATGG + Intronic
1033461485 7:141551072-141551094 ATGAACAAGGCCATTGGAGATGG - Intergenic
1033587926 7:142788012-142788034 AAGGAGAAGGTCACAGAAGAGGG + Intergenic
1033895237 7:146061061-146061083 ATGGAGAAAGACAGTGAAGATGG + Intergenic
1034129430 7:148701331-148701353 AGGGAGAAGGGAAGTGAAGAGGG - Intronic
1034788066 7:153943457-153943479 ATGGAGAAGGACAAAAAAGAGGG - Intronic
1036058962 8:5293370-5293392 AAGTAGAAGACCACGGAAGAAGG - Intergenic
1037377585 8:18248711-18248733 GTGGAGAAGGCCAGAGAAGGAGG + Intergenic
1037941647 8:22955976-22955998 ATGGAGACGGGCACTAAGGAAGG + Intronic
1040518106 8:48150850-48150872 ACCGGGAGGGCCACTGAAGAGGG + Intergenic
1041141160 8:54820689-54820711 AGGGAAAGGGACACTGAAGATGG - Intergenic
1043361633 8:79479280-79479302 CAGGAGAAGGTCACTGAAGCTGG + Intergenic
1045375471 8:101569364-101569386 TTAGAGAAGGGCACTGAATAGGG + Intronic
1046481714 8:114828343-114828365 ATGCAGAAGAACACTCAAGAAGG + Intergenic
1048007091 8:130428178-130428200 AGTGAGATGGACACTGAAGAGGG - Intronic
1048547304 8:135399023-135399045 ATGGAGAAGGCAACAGGAAAGGG - Intergenic
1048900710 8:139034836-139034858 ATGGAGCAGGCCATGGGAGAGGG - Intergenic
1049342454 8:142120493-142120515 AGGGAGAAGGCCTGTGAAGATGG - Intergenic
1049513147 8:143039757-143039779 GTGGAGAGGGTCACTGGAGAGGG + Intronic
1051157793 9:14170330-14170352 ATGCAGGAGGCCACCGTAGAAGG + Intronic
1053282304 9:36828567-36828589 ATAGGGAAGGCCCCTGAAGAGGG - Intergenic
1053528791 9:38857078-38857100 ATGAAGAAGCCAACTGAGGAAGG + Intergenic
1054201018 9:62081511-62081533 ATGAAGAAGCCAACTGAGGAAGG + Intergenic
1054637341 9:67506852-67506874 ATGAAGAAGCCAACTGAGGAAGG - Intergenic
1055656126 9:78452091-78452113 ATGGAGAACATCACAGAAGAAGG - Intergenic
1056900435 9:90594379-90594401 AGGGAGGAAGCCAGTGAAGAAGG - Intergenic
1057210496 9:93198552-93198574 ATGGGGATGGCCACTGTGGAGGG + Intronic
1059067368 9:111099589-111099611 ATGGAGGAGGCTAATTAAGAAGG - Intergenic
1059130868 9:111748257-111748279 AAGGAAAATGCCACTGAACAAGG - Intronic
1060530364 9:124344139-124344161 AGAGAGAAGGGCACAGAAGAGGG - Intronic
1061841396 9:133360363-133360385 AGAGAGAAGGCCACTGATGAGGG + Exonic
1062069510 9:134547963-134547985 AAGGAGATGGTCACTGAAGCGGG - Intergenic
1186559735 X:10598632-10598654 TTGGAGATGGCCACTTAAGAAGG + Intronic
1186863917 X:13700342-13700364 TTGGAGAAGGCCAGAGAAAAGGG + Intronic
1188071939 X:25727800-25727822 AAGGAAAAAGGCACTGAAGAGGG - Intergenic
1188091384 X:25968924-25968946 ATGGCGCTGGCCACTGAAGGGGG + Intergenic
1189364512 X:40377984-40378006 ATGGAGGAGGCCACAGAACAAGG + Intergenic
1189425361 X:40895614-40895636 AAGGGCAAGGCCACTGAAGATGG - Intergenic
1190368377 X:49718779-49718801 ATGGAAAGAGGCACTGAAGAGGG - Intergenic
1191899616 X:66027300-66027322 ATGGTCAAGGGCACTGAGGATGG - Intronic
1192502398 X:71662676-71662698 AGGGAGAAAAGCACTGAAGAAGG + Intergenic
1193658131 X:84223542-84223564 TGGCAGCAGGCCACTGAAGAAGG + Intergenic
1195493936 X:105507867-105507889 AAGGAGAAAGCCACTGAAATAGG - Intronic
1195724718 X:107902714-107902736 ATGGAGCAACCCTCTGAAGAGGG + Intronic
1198243208 X:134804742-134804764 ATGAAGCAGGCCAGTGAACAAGG - Intronic
1199187720 X:144936946-144936968 AGAGAGAAGTCCACTGAAAAGGG + Intergenic
1200062895 X:153491504-153491526 AGGGAGAGGGCCACGGAAGAAGG - Intronic
1200766291 Y:7083484-7083506 GTGGAGGGGGCCACTGAAGAGGG - Intronic