ID: 1079944843

View in Genome Browser
Species Human (GRCh38)
Location 11:26729237-26729259
Sequence GTGGAAAAGAAGGATGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079944843_1079944847 9 Left 1079944843 11:26729237-26729259 CCTTCCTCATCCTTCTTTTCCAC No data
Right 1079944847 11:26729269-26729291 GAGACAGAAACTAAAAACCATGG 0: 56
1: 73
2: 34
3: 60
4: 539

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079944843 Original CRISPR GTGGAAAAGAAGGATGAGGA AGG (reversed) Intergenic
No off target data available for this crispr