ID: 1079947195

View in Genome Browser
Species Human (GRCh38)
Location 11:26758941-26758963
Sequence ATGACCAGGGTGACCATGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079947191_1079947195 26 Left 1079947191 11:26758892-26758914 CCAGACTCTTCATTTATTTTTTC No data
Right 1079947195 11:26758941-26758963 ATGACCAGGGTGACCATGTTTGG No data
1079947190_1079947195 27 Left 1079947190 11:26758891-26758913 CCCAGACTCTTCATTTATTTTTT No data
Right 1079947195 11:26758941-26758963 ATGACCAGGGTGACCATGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079947195 Original CRISPR ATGACCAGGGTGACCATGTT TGG Intergenic
No off target data available for this crispr