ID: 1079954568

View in Genome Browser
Species Human (GRCh38)
Location 11:26846868-26846890
Sequence TTCTTCCAATGCAAAATCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079954568_1079954570 27 Left 1079954568 11:26846868-26846890 CCATGGATTTTGCATTGGAAGAA No data
Right 1079954570 11:26846918-26846940 AATAAGGAATTACATTTTTGAGG No data
1079954568_1079954569 11 Left 1079954568 11:26846868-26846890 CCATGGATTTTGCATTGGAAGAA No data
Right 1079954569 11:26846902-26846924 GTAGACACGCAATTATAATAAGG No data
1079954568_1079954571 28 Left 1079954568 11:26846868-26846890 CCATGGATTTTGCATTGGAAGAA No data
Right 1079954571 11:26846919-26846941 ATAAGGAATTACATTTTTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079954568 Original CRISPR TTCTTCCAATGCAAAATCCA TGG (reversed) Intergenic
No off target data available for this crispr