ID: 1079954571

View in Genome Browser
Species Human (GRCh38)
Location 11:26846919-26846941
Sequence ATAAGGAATTACATTTTTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079954568_1079954571 28 Left 1079954568 11:26846868-26846890 CCATGGATTTTGCATTGGAAGAA No data
Right 1079954571 11:26846919-26846941 ATAAGGAATTACATTTTTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079954571 Original CRISPR ATAAGGAATTACATTTTTGA GGG Intergenic
No off target data available for this crispr