ID: 1079960001

View in Genome Browser
Species Human (GRCh38)
Location 11:26912361-26912383
Sequence CAATATCACAACATTCACAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079959994_1079960001 13 Left 1079959994 11:26912325-26912347 CCCTATCTCCCTTTCTGAATACA No data
Right 1079960001 11:26912361-26912383 CAATATCACAACATTCACATAGG No data
1079959996_1079960001 5 Left 1079959996 11:26912333-26912355 CCCTTTCTGAATACAATATGACC No data
Right 1079960001 11:26912361-26912383 CAATATCACAACATTCACATAGG No data
1079959997_1079960001 4 Left 1079959997 11:26912334-26912356 CCTTTCTGAATACAATATGACCT No data
Right 1079960001 11:26912361-26912383 CAATATCACAACATTCACATAGG No data
1079959995_1079960001 12 Left 1079959995 11:26912326-26912348 CCTATCTCCCTTTCTGAATACAA No data
Right 1079960001 11:26912361-26912383 CAATATCACAACATTCACATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079960001 Original CRISPR CAATATCACAACATTCACAT AGG Intergenic
No off target data available for this crispr