ID: 1079962625

View in Genome Browser
Species Human (GRCh38)
Location 11:26942874-26942896
Sequence TTCTATTTAGACTTCCTTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079962625_1079962626 14 Left 1079962625 11:26942874-26942896 CCAACAAGGAAGTCTAAATAGAA No data
Right 1079962626 11:26942911-26942933 CTCATATGCTTTTGTTGACACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079962625 Original CRISPR TTCTATTTAGACTTCCTTGT TGG (reversed) Intergenic
No off target data available for this crispr