ID: 1079963754

View in Genome Browser
Species Human (GRCh38)
Location 11:26955112-26955134
Sequence TATTACCTGTAGCCTTTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079963754_1079963758 19 Left 1079963754 11:26955112-26955134 CCTTCCAAAGGCTACAGGTAATA No data
Right 1079963758 11:26955154-26955176 TTTGATTGTTGTATTTATTTGGG No data
1079963754_1079963759 30 Left 1079963754 11:26955112-26955134 CCTTCCAAAGGCTACAGGTAATA No data
Right 1079963759 11:26955165-26955187 TATTTATTTGGGCAATAATGAGG No data
1079963754_1079963757 18 Left 1079963754 11:26955112-26955134 CCTTCCAAAGGCTACAGGTAATA No data
Right 1079963757 11:26955153-26955175 GTTTGATTGTTGTATTTATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079963754 Original CRISPR TATTACCTGTAGCCTTTGGA AGG (reversed) Intergenic
No off target data available for this crispr