ID: 1079963758

View in Genome Browser
Species Human (GRCh38)
Location 11:26955154-26955176
Sequence TTTGATTGTTGTATTTATTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079963752_1079963758 23 Left 1079963752 11:26955108-26955130 CCCACCTTCCAAAGGCTACAGGT No data
Right 1079963758 11:26955154-26955176 TTTGATTGTTGTATTTATTTGGG No data
1079963753_1079963758 22 Left 1079963753 11:26955109-26955131 CCACCTTCCAAAGGCTACAGGTA No data
Right 1079963758 11:26955154-26955176 TTTGATTGTTGTATTTATTTGGG No data
1079963756_1079963758 15 Left 1079963756 11:26955116-26955138 CCAAAGGCTACAGGTAATAAGGA No data
Right 1079963758 11:26955154-26955176 TTTGATTGTTGTATTTATTTGGG No data
1079963754_1079963758 19 Left 1079963754 11:26955112-26955134 CCTTCCAAAGGCTACAGGTAATA No data
Right 1079963758 11:26955154-26955176 TTTGATTGTTGTATTTATTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079963758 Original CRISPR TTTGATTGTTGTATTTATTT GGG Intergenic
No off target data available for this crispr