ID: 1079963759

View in Genome Browser
Species Human (GRCh38)
Location 11:26955165-26955187
Sequence TATTTATTTGGGCAATAATG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079963756_1079963759 26 Left 1079963756 11:26955116-26955138 CCAAAGGCTACAGGTAATAAGGA No data
Right 1079963759 11:26955165-26955187 TATTTATTTGGGCAATAATGAGG No data
1079963754_1079963759 30 Left 1079963754 11:26955112-26955134 CCTTCCAAAGGCTACAGGTAATA No data
Right 1079963759 11:26955165-26955187 TATTTATTTGGGCAATAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079963759 Original CRISPR TATTTATTTGGGCAATAATG AGG Intergenic
No off target data available for this crispr