ID: 1079963759 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 11:26955165-26955187 |
Sequence | TATTTATTTGGGCAATAATG AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1079963756_1079963759 | 26 | Left | 1079963756 | 11:26955116-26955138 | CCAAAGGCTACAGGTAATAAGGA | No data | ||
Right | 1079963759 | 11:26955165-26955187 | TATTTATTTGGGCAATAATGAGG | No data | ||||
1079963754_1079963759 | 30 | Left | 1079963754 | 11:26955112-26955134 | CCTTCCAAAGGCTACAGGTAATA | No data | ||
Right | 1079963759 | 11:26955165-26955187 | TATTTATTTGGGCAATAATGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1079963759 | Original CRISPR | TATTTATTTGGGCAATAATG AGG | Intergenic | ||
No off target data available for this crispr |