ID: 1079966532

View in Genome Browser
Species Human (GRCh38)
Location 11:26987051-26987073
Sequence CCCACTTCATAACTCACAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079966532_1079966537 2 Left 1079966532 11:26987051-26987073 CCACCTGTGAGTTATGAAGTGGG No data
Right 1079966537 11:26987076-26987098 CTCACAGACACCAAATCTGCTGG 0: 7
1: 2
2: 22
3: 114
4: 597
1079966532_1079966539 16 Left 1079966532 11:26987051-26987073 CCACCTGTGAGTTATGAAGTGGG No data
Right 1079966539 11:26987090-26987112 ATCTGCTGGTACCTTGATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079966532 Original CRISPR CCCACTTCATAACTCACAGG TGG (reversed) Intergenic
No off target data available for this crispr