ID: 1079966534

View in Genome Browser
Species Human (GRCh38)
Location 11:26987054-26987076
Sequence GGGCCCACTTCATAACTCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079966534_1079966539 13 Left 1079966534 11:26987054-26987076 CCTGTGAGTTATGAAGTGGGCCC No data
Right 1079966539 11:26987090-26987112 ATCTGCTGGTACCTTGATTTTGG No data
1079966534_1079966537 -1 Left 1079966534 11:26987054-26987076 CCTGTGAGTTATGAAGTGGGCCC No data
Right 1079966537 11:26987076-26987098 CTCACAGACACCAAATCTGCTGG 0: 7
1: 2
2: 22
3: 114
4: 597

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079966534 Original CRISPR GGGCCCACTTCATAACTCAC AGG (reversed) Intergenic
No off target data available for this crispr