ID: 1079966535

View in Genome Browser
Species Human (GRCh38)
Location 11:26987074-26987096
Sequence AGCAGATTTGGTGTCTGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079966535_1079966539 -7 Left 1079966535 11:26987074-26987096 CCCTCACAGACACCAAATCTGCT No data
Right 1079966539 11:26987090-26987112 ATCTGCTGGTACCTTGATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079966535 Original CRISPR AGCAGATTTGGTGTCTGTGA GGG (reversed) Intergenic
No off target data available for this crispr