ID: 1079966539

View in Genome Browser
Species Human (GRCh38)
Location 11:26987090-26987112
Sequence ATCTGCTGGTACCTTGATTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079966535_1079966539 -7 Left 1079966535 11:26987074-26987096 CCCTCACAGACACCAAATCTGCT No data
Right 1079966539 11:26987090-26987112 ATCTGCTGGTACCTTGATTTTGG No data
1079966532_1079966539 16 Left 1079966532 11:26987051-26987073 CCACCTGTGAGTTATGAAGTGGG No data
Right 1079966539 11:26987090-26987112 ATCTGCTGGTACCTTGATTTTGG No data
1079966530_1079966539 19 Left 1079966530 11:26987048-26987070 CCACCACCTGTGAGTTATGAAGT No data
Right 1079966539 11:26987090-26987112 ATCTGCTGGTACCTTGATTTTGG No data
1079966536_1079966539 -8 Left 1079966536 11:26987075-26987097 CCTCACAGACACCAAATCTGCTG No data
Right 1079966539 11:26987090-26987112 ATCTGCTGGTACCTTGATTTTGG No data
1079966534_1079966539 13 Left 1079966534 11:26987054-26987076 CCTGTGAGTTATGAAGTGGGCCC No data
Right 1079966539 11:26987090-26987112 ATCTGCTGGTACCTTGATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079966539 Original CRISPR ATCTGCTGGTACCTTGATTT TGG Intergenic
No off target data available for this crispr