ID: 1079967167

View in Genome Browser
Species Human (GRCh38)
Location 11:26994029-26994051
Sequence GGTTTCGTCACTTGGAAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 108}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079967167_1079967170 9 Left 1079967167 11:26994029-26994051 CCTGGCTTCCAAGTGACGAAACC 0: 1
1: 0
2: 0
3: 3
4: 108
Right 1079967170 11:26994061-26994083 TTGAGAGCAGAGAGATCCTCAGG 0: 1
1: 1
2: 0
3: 18
4: 197
1079967167_1079967172 26 Left 1079967167 11:26994029-26994051 CCTGGCTTCCAAGTGACGAAACC 0: 1
1: 0
2: 0
3: 3
4: 108
Right 1079967172 11:26994078-26994100 CTCAGGATATCTTTAGCCAAAGG 0: 1
1: 0
2: 1
3: 18
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079967167 Original CRISPR GGTTTCGTCACTTGGAAGCC AGG (reversed) Intergenic
900420171 1:2552818-2552840 GGTTTCCTCACCTGGAAGGTGGG + Intergenic
900424260 1:2568840-2568862 GGTTTCCTCACCTGGAAGGTGGG - Intergenic
900742498 1:4339284-4339306 GGCTTCCTCACATAGAAGCCTGG + Intergenic
902563721 1:17295907-17295929 GGTGCCGGCACTTGGAGGCCGGG - Intergenic
902564707 1:17303775-17303797 GGTTTCCTCACCTGGAAAACGGG + Intergenic
902651319 1:17839452-17839474 GGTGTCCTCACTTGGTAGCTGGG - Intergenic
903107179 1:21092319-21092341 GGCTTCGTCACTGGGATGCAAGG - Intronic
905586866 1:39126833-39126855 GGTTTAGTCACTTTGTAACCTGG + Intronic
921747600 1:218754984-218755006 GGTTTCCTGACCAGGAAGCCAGG - Intergenic
1066317336 10:34260890-34260912 GGTTGCGTCAAAGGGAAGCCTGG - Intronic
1070827221 10:79398307-79398329 GGTTTCCTCATCTGGAAACCAGG + Intronic
1072089157 10:92110043-92110065 GGTTTCCTCACCTGGAAGATGGG - Intronic
1073013909 10:100382962-100382984 GGTTTCCTCACCTGGAACTCTGG - Intergenic
1075247794 10:120839483-120839505 GGTTTTCTCACTTCCAAGCCAGG - Intergenic
1076084635 10:127615533-127615555 GATTTTGTGACTTGGAAGCAAGG + Intergenic
1077996249 11:7454776-7454798 GGTTTCTTCACTAGGGTGCCAGG + Intronic
1079967167 11:26994029-26994051 GGTTTCGTCACTTGGAAGCCAGG - Intergenic
1080793185 11:35539320-35539342 GGTTTCTTCACTCAGAATCCTGG - Intergenic
1081843316 11:46219445-46219467 GGTTTTGTCACTTGCAAAACAGG + Intergenic
1084857074 11:71996236-71996258 GGCTTCGATACTTGGTAGCCTGG + Exonic
1086056138 11:82649355-82649377 GGTTCCATCACTTGGTTGCCTGG - Intergenic
1086894463 11:92295963-92295985 GTTTTGGTCACTTGGATGGCTGG + Intergenic
1087939903 11:104083356-104083378 GTTTTTGTCACTTATAAGCCGGG - Intronic
1088870176 11:113884063-113884085 GGTTTCCTCACTTGTAAAGCAGG - Intergenic
1090606618 11:128428691-128428713 GGTCTGGTCACTTGGAGGCCTGG - Intergenic
1093060962 12:14603386-14603408 GATTATGTCACTTGGAAGCAGGG + Intergenic
1093333502 12:17871702-17871724 GGTTTCGTCCCTGGGATGCAAGG + Intergenic
1094154228 12:27320710-27320732 AGTTTCCTCACTTGTAAGACAGG - Intronic
1099825437 12:87771114-87771136 GGCTTATTCTCTTGGAAGCCAGG + Intergenic
1101850970 12:108401932-108401954 GGTTTTCCCACTTGGATGCCAGG - Intergenic
1104901795 12:132193388-132193410 GGTTTCGGCAGTTGTGAGCCTGG + Intergenic
1106199925 13:27527713-27527735 GGTTTCCTCACCTGAAAACCAGG + Intergenic
1107645674 13:42492144-42492166 GGTTTGTTAACATGGAAGCCAGG + Intergenic
1109917788 13:69014761-69014783 GGTTTCCTCACTGGGAGGACAGG - Intergenic
1113393058 13:109916353-109916375 GGTGTAGTCACTCTGAAGCCTGG - Intergenic
1119928497 14:78520593-78520615 GGTTTCACCACTTAGAAGCTGGG + Intronic
1202876976 14_KI270722v1_random:12276-12298 GGTTTCATCCCTTGGATGCAAGG + Intergenic
1126924989 15:53574928-53574950 GATTTCCTCACTTGGAAGTGAGG - Intronic
1127193115 15:56553760-56553782 GGTTTTGTCATTTGGCAGCAGGG - Intergenic
1127317505 15:57811464-57811486 GGCTTCGTCACTGGGATGCAAGG - Intergenic
1127934521 15:63624057-63624079 GGTTTCCTCACTTCTAAGGCAGG - Intronic
1133827164 16:9288339-9288361 GGCCTCGACACTGGGAAGCCTGG + Intergenic
1134815571 16:17203004-17203026 GGTTTCCTCATTTGGAAAGCGGG - Intronic
1135532854 16:23269547-23269569 GGTTTCCTCACTGTGAACCCAGG + Intergenic
1137836973 16:51601632-51601654 GGTTTCGTAACTTGCAAGAGTGG - Intergenic
1139269566 16:65669746-65669768 GGATCCTTCACTTGGTAGCCAGG - Intergenic
1140867701 16:79078322-79078344 GGTTTTGTTACTTGCAAGGCAGG + Intronic
1142977424 17:3654034-3654056 TGCTTTGTCACTTGGCAGCCAGG + Intronic
1143026759 17:3945567-3945589 GGTTTCCTCCCTTGAAGGCCAGG - Intronic
1143996654 17:11012268-11012290 GTTTTCCTCACTTGGATTCCAGG - Intergenic
1144201972 17:12949719-12949741 GGGGTACTCACTTGGAAGCCTGG - Exonic
1146914095 17:36667012-36667034 GGTTTCCTGACCTGAAAGCCTGG - Intergenic
1147832918 17:43309763-43309785 AGTGTGGTCACTTGGAAGCCTGG + Intergenic
1152574783 17:81135231-81135253 GGTGTCCTGATTTGGAAGCCGGG - Intronic
1156228407 18:35131037-35131059 GGGTACGTCACTGGGAAGGCAGG - Intronic
1157854751 18:51095140-51095162 GGTTTCATCCCTGGGATGCCAGG - Intergenic
1159281837 18:66295616-66295638 GGCTTCATCACTGGGATGCCAGG + Intergenic
1165061770 19:33208285-33208307 GGTTTCCCCACCTGTAAGCCAGG + Exonic
1166775966 19:45312613-45312635 GGTTTCTCCACTTGGGCGCCTGG + Intronic
1167297286 19:48658926-48658948 GTCTTCTTCACATGGAAGCCAGG - Intergenic
1167942235 19:52957211-52957233 GGTTCCCTGACTTGGAAGCGAGG + Intronic
1168612996 19:57815730-57815752 GGTTCCCTGACTGGGAAGCCAGG + Intronic
1202673699 1_KI270710v1_random:20656-20678 GGTTTCATCCCTTGGATGCAAGG - Intergenic
925232854 2:2251442-2251464 GGTTTCTGCACCTGGAAGCGTGG - Intronic
931275265 2:60738713-60738735 GGTTTCTTCACTTACATGCCTGG + Intergenic
932383355 2:71306619-71306641 GTATTTGTCACTTGCAAGCCAGG - Intronic
933813567 2:86048414-86048436 GGTTTCCTCACCTGGAAGTGGGG - Intronic
934748303 2:96774320-96774342 TCTTTGGTCACTTGGAGGCCAGG + Intronic
936159440 2:110072569-110072591 GGCTTCGTCCCTGGGAAGCAAGG - Intergenic
936185221 2:110298763-110298785 GGCTTCGTCCCTGGGAAGCAAGG + Intergenic
936911101 2:117594720-117594742 GGCTTCGTCCCTGGGAAGCAAGG - Intergenic
939053832 2:137338120-137338142 GGTTTCTTTAGTTTGAAGCCTGG + Intronic
942831718 2:180244443-180244465 GGTTTCGTCAATGGGGACCCCGG + Intergenic
945024557 2:205607500-205607522 GGTTTCCTCATCTGAAAGCCAGG + Intronic
945434226 2:209799898-209799920 GGCTTCATCACTGGGAAGCAAGG - Intronic
948670607 2:239566324-239566346 GGCTTCGTCCCCTGGAAACCGGG - Intergenic
1173440973 20:43075908-43075930 GGTTTCGACCCTTTGAAACCTGG - Intronic
1174767813 20:53270424-53270446 GGTTTCTTCACCTGTAAGCTGGG - Intronic
952742259 3:36745917-36745939 TGTTTCGTAACTCAGAAGCCTGG + Intergenic
953771354 3:45780578-45780600 GGTTGAGTCACCTGGTAGCCAGG + Intronic
957440130 3:80234741-80234763 GCTTTACTCATTTGGAAGCCTGG - Intergenic
965473019 3:169118873-169118895 GTTTTCGGCACTTGAAGGCCTGG + Intronic
975350781 4:73343617-73343639 GGTTCTGTCAGTGGGAAGCCTGG - Intergenic
984012579 4:174388345-174388367 GGTGTCCTCACATGGAAACCAGG - Intergenic
986395560 5:7326108-7326130 TGTTTCGTCATCTGGAACCCAGG + Intergenic
986808767 5:11333760-11333782 GGTTTGCTCACTTGGCAGGCAGG + Intronic
987056656 5:14199823-14199845 GGTTTCTTCAGTTGGAAGTAAGG + Intronic
992834065 5:80622868-80622890 GCTTTTGTAACTTGGAAGCAAGG - Intergenic
995050446 5:107697240-107697262 GGTATAGTCTCCTGGAAGCCTGG + Intergenic
1007474362 6:42108875-42108897 GGTTTCTTCAGTTTGAAGTCAGG - Intronic
1008727668 6:54441741-54441763 GGTTGGGCCACTTGGCAGCCCGG + Intergenic
1010658067 6:78535906-78535928 AGTTTCTTCACTTGGATGACAGG + Intergenic
1012163802 6:95923348-95923370 GGTTTTGTCATTTGTTAGCCAGG + Intergenic
1016392940 6:143592851-143592873 GGTTTCGCCATTTTGCAGCCTGG - Intronic
1016470085 6:144366176-144366198 TGTTTATTCACTTGAAAGCCAGG + Intronic
1018239732 6:161761612-161761634 GGTTTTCTTACTTGGAAGCCAGG - Intronic
1021325590 7:19263132-19263154 GGTTTTTGCACTTGGAAGCAGGG + Intergenic
1029951340 7:104589440-104589462 GGTTTCATCACTGGGATGCAAGG - Intronic
1032883106 7:136111190-136111212 GGTTTCATCCCTTGGATGCAAGG - Intergenic
1034371417 7:150600887-150600909 GGTTTCATCACTGGGATGCAAGG + Intergenic
1035746350 8:1964220-1964242 GGTCTCTGCACGTGGAAGCCTGG - Intergenic
1037206545 8:16327869-16327891 GGCTTTGCCACTTGGAAGCTGGG - Intronic
1039912585 8:41836567-41836589 GTTTTCGCCGGTTGGAAGCCAGG - Intronic
1042946541 8:74160315-74160337 TGTTTCGTCACTGGGATGCAAGG + Intergenic
1044780702 8:95740684-95740706 GGTTTCAGAACTTGGCAGCCGGG + Intergenic
1049209924 8:141381213-141381235 AATTTCCTCACTGGGAAGCCTGG + Intergenic
1055740592 9:79383975-79383997 GGATTCGTCACTGTGAATCCTGG - Intergenic
1056493934 9:87137042-87137064 GGTGTCAGCACTTGGAAGGCGGG - Intergenic
1062119634 9:134827394-134827416 GGGTTTGTCACTAGGAAGGCAGG - Intronic
1186405740 X:9300803-9300825 GGTGTCGGCAGTTGGAAGACAGG - Intergenic
1198566403 X:137909830-137909852 GGTTTCTTCACATGGCTGCCTGG - Intergenic
1201171460 Y:11270329-11270351 GGTTTCATCCCTTGGATGCAAGG - Intergenic