ID: 1079967856 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 11:27000958-27000980 |
Sequence | ATTCTAGGATTGATGATAAA TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1079967852_1079967856 | 26 | Left | 1079967852 | 11:27000909-27000931 | CCTTTCTGAAGGCAGTAGACTGG | No data | ||
Right | 1079967856 | 11:27000958-27000980 | ATTCTAGGATTGATGATAAATGG | No data | ||||
1079967851_1079967856 | 27 | Left | 1079967851 | 11:27000908-27000930 | CCCTTTCTGAAGGCAGTAGACTG | No data | ||
Right | 1079967856 | 11:27000958-27000980 | ATTCTAGGATTGATGATAAATGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1079967856 | Original CRISPR | ATTCTAGGATTGATGATAAA TGG | Intergenic | ||
No off target data available for this crispr |