ID: 1079967856

View in Genome Browser
Species Human (GRCh38)
Location 11:27000958-27000980
Sequence ATTCTAGGATTGATGATAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079967852_1079967856 26 Left 1079967852 11:27000909-27000931 CCTTTCTGAAGGCAGTAGACTGG No data
Right 1079967856 11:27000958-27000980 ATTCTAGGATTGATGATAAATGG No data
1079967851_1079967856 27 Left 1079967851 11:27000908-27000930 CCCTTTCTGAAGGCAGTAGACTG No data
Right 1079967856 11:27000958-27000980 ATTCTAGGATTGATGATAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079967856 Original CRISPR ATTCTAGGATTGATGATAAA TGG Intergenic
No off target data available for this crispr