ID: 1079973478

View in Genome Browser
Species Human (GRCh38)
Location 11:27064225-27064247
Sequence AGGATGTCCCAACAGTATCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 83}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079973478 Original CRISPR AGGATGTCCCAACAGTATCA GGG Intronic
900800272 1:4732875-4732897 AGGATCTCCCAAGAGCGTCAGGG - Intronic
902112431 1:14093584-14093606 AGAATGTCCCAATTGTCTCAGGG - Intergenic
903190442 1:21652894-21652916 AGGAGGCCCCCACAGTCTCAAGG + Intronic
905928650 1:41770696-41770718 AGTATGTTCCAAAAGTGTCAAGG + Intronic
908561562 1:65311134-65311156 AGAATGTCCCATCAATATCTTGG - Intronic
913182317 1:116334107-116334129 AGGAGGTACCAACAGAAGCAAGG + Intergenic
915514227 1:156403382-156403404 AGGACTTCCCAACAATAACAAGG - Intergenic
924547106 1:245039718-245039740 AGGATTTTTCAAAAGTATCAAGG - Intronic
1066078601 10:31906680-31906702 AGGATTTCCAAACAGTGTTAAGG + Intronic
1068946932 10:62738950-62738972 AGGATGTGGCAACTATATCATGG + Intergenic
1069922367 10:71824001-71824023 AGGATGTCCCAAGAGGTTCAGGG + Intronic
1071344536 10:84680122-84680144 AGGATTTCTTACCAGTATCAGGG - Intergenic
1077959653 11:7061643-7061665 AGGATATGACAACAGTCTCAGGG + Intronic
1079973478 11:27064225-27064247 AGGATGTCCCAACAGTATCAGGG + Intronic
1084898341 11:72292162-72292184 AGCATGTCCTAACAGTATGGTGG - Intergenic
1089811322 11:121134256-121134278 AAGATGCCCCAACAGCAACAGGG - Intronic
1097974997 12:65675984-65676006 AGGATGACAGAATAGTATCATGG - Intergenic
1098470017 12:70832652-70832674 AGGATATCACAACAGTCCCAGGG + Intronic
1103199961 12:119079774-119079796 AGGCGATCCCAACAGTTTCATGG - Intronic
1103872122 12:124099581-124099603 AGGCTGGCCCTACAGTATCCAGG + Intronic
1110629391 13:77690271-77690293 AGGAAGTCCCATCAATTTCAAGG + Intergenic
1111158551 13:84361550-84361572 GGTATGTTCCAAGAGTATCAAGG - Intergenic
1119422216 14:74514117-74514139 AGGCTGTCCCACCAGCATCTTGG + Intronic
1130696481 15:86136642-86136664 ATTATGTACCAAGAGTATCATGG - Intergenic
1131211554 15:90502009-90502031 AGGATGCCCCAACAAACTCATGG + Exonic
1132194334 15:99899411-99899433 AGGATGTTTCTACAGTAACAAGG + Intergenic
1140903056 16:79387669-79387691 AGCATGTTCAAACAGTATAAAGG + Intergenic
1147587794 17:41662696-41662718 AGGAGGTCCTAACAGCAGCAGGG - Intergenic
1150930855 17:69583531-69583553 AGGATGTCCTATGGGTATCAAGG + Intergenic
1157751156 18:50179672-50179694 AGGCTGTCCCATCAGCAGCAGGG - Intronic
1158277369 18:55782563-55782585 TGGATGGGCCAACATTATCATGG + Intergenic
1168704498 19:58461744-58461766 TGGGTGTCCCACCAGCATCAGGG + Intergenic
927101606 2:19791777-19791799 AGGGTGTCCCAAAACTCTCAAGG - Intergenic
930683648 2:54284884-54284906 AGGGGGTCTCAACAGTCTCATGG - Intronic
939869597 2:147512165-147512187 AGGAATACCCAACAGTACCAGGG + Intergenic
940978458 2:159973804-159973826 AGAATGCCCCATCAGTTTCATGG - Intronic
946884948 2:224213947-224213969 AGCATGTCCCAAATATATCATGG + Intergenic
947182350 2:227422441-227422463 AGGATGTCTCAAGACTATCAAGG + Intergenic
949006944 2:241655123-241655145 AGGATGCCCCAACAAGATCGGGG - Intronic
1174522282 20:51141032-51141054 TGGAAGTCCCTACAGGATCAGGG + Intergenic
1179247409 21:39645730-39645752 AGGTTGTCCCAACTGGAACAGGG - Intronic
1182730280 22:32484072-32484094 AAGATGTATCAACACTATCAAGG - Exonic
1183252963 22:36743373-36743395 AGGTTGCCCCAAAAGTAGCATGG - Intergenic
1185014405 22:48334736-48334758 AAGATGTCCCCAAAATATCATGG + Intergenic
950111947 3:10424394-10424416 AGGCTGTCTCAAGAGTAACAAGG - Intronic
951034350 3:17916573-17916595 TGGATGTCCCTACAGTATTCTGG - Intronic
955955937 3:64290197-64290219 AGGGTATCCCAACAGCATTAAGG + Intronic
956816892 3:72915883-72915905 AGGCTGGCCCAGCAGTGTCAGGG + Intronic
960071257 3:113433797-113433819 AGGATGACCCACCAGTAGGAGGG + Intronic
961091844 3:124119615-124119637 AGGCTGTCCCAACATGAGCAGGG + Intronic
965209841 3:165770812-165770834 AGTAAGTCCAACCAGTATCAGGG - Intergenic
966955502 3:184873806-184873828 AGATTGTTTCAACAGTATCATGG - Intronic
969896691 4:10312001-10312023 GGGATATCCAAACTGTATCAGGG - Intergenic
969896890 4:10313729-10313751 GGGATATCCAAACTGTATCAGGG - Intergenic
973261525 4:48169448-48169470 AGGATATCCCAAGAGAATCAGGG + Intronic
976616098 4:87078862-87078884 AGGCGGTGCCAACATTATCAAGG - Intronic
977250544 4:94683871-94683893 AGTATCTCCCAACACTATCATGG - Intergenic
978037422 4:104012707-104012729 AGGATGTCCCAATACTGACAAGG + Intergenic
982302922 4:153898630-153898652 AGAATGTCCCATCATTATTAAGG + Intergenic
983770669 4:171545062-171545084 AGGAAGTCCAAAAAGTAGCAGGG + Intergenic
986854906 5:11857264-11857286 AGGATGTGCCAGCCATATCAAGG + Intronic
988734439 5:34006931-34006953 AGGCTGTCACACCAGTGTCAAGG + Intronic
998348407 5:141484915-141484937 AGAACGTCCCAACAGCAGCAGGG - Intronic
1001515834 5:172354837-172354859 AGGATGGTCCCACAGTTTCAGGG - Intronic
1001529241 5:172450941-172450963 AGGCTCTCCAAACAATATCATGG + Intronic
1011757122 6:90511172-90511194 AGAATGTACTAATAGTATCATGG + Intergenic
1012964385 6:105657572-105657594 AGGAGGTCAGAACAGTTTCAGGG + Intergenic
1013531696 6:111025426-111025448 AAGTTGTACCAAAAGTATCATGG - Exonic
1015516081 6:134083807-134083829 AGGGGATCCCATCAGTATCAGGG + Intergenic
1017767268 6:157616751-157616773 AGGGTCTCCCAACATTCTCATGG - Intronic
1021217632 7:17936951-17936973 AGGAAGTCCTAACAGGAGCAAGG + Intronic
1022981291 7:35607071-35607093 AAGACTTCCCAACACTATCAGGG + Intergenic
1024593644 7:50913610-50913632 AGGCTGTACCAACAGGCTCAAGG + Intergenic
1026167299 7:67921873-67921895 AGGATGTCAAATCAGTCTCAAGG + Intergenic
1026275228 7:68870513-68870535 AGGATGTCCAGAAAGTGTCATGG + Intergenic
1027908229 7:84213866-84213888 AGGTTGCCCCAGCACTATCATGG + Intronic
1038076546 8:24081908-24081930 AGGATGTCTCAAAACTTTCAAGG - Intergenic
1046584704 8:116136836-116136858 AGTATGTCCCAAAAATGTCATGG - Intergenic
1047172431 8:122506863-122506885 AGGATGTCTCAACTGTACCTAGG + Intergenic
1048821745 8:138386523-138386545 AGGAAGTCCCAACAGCATTAGGG + Intronic
1050886873 9:10777941-10777963 AGGATGTCCCTACAGTTTAGGGG - Intergenic
1051666403 9:19470727-19470749 ATGGTGTCACATCAGTATCATGG - Intergenic
1054864150 9:69982845-69982867 ATCTTGTCCCAACAATATCATGG + Intergenic
1059845179 9:118267645-118267667 ATGATGTCCTGGCAGTATCAAGG + Intergenic
1060085085 9:120691432-120691454 AAGATGCCCCAAAAGTATCTAGG - Intronic
1060419786 9:123459881-123459903 AGGATGACCCAAAAATATTAGGG + Intronic
1187483669 X:19681769-19681791 AGGAAGTCCCAGCAGTAACGAGG + Intronic
1196103337 X:111870425-111870447 AGCATGTCCCAAAATTATAAGGG - Intronic
1197647347 X:129032396-129032418 AGGATGTCCTATCAGGGTCATGG + Intergenic