ID: 1079975309

View in Genome Browser
Species Human (GRCh38)
Location 11:27083740-27083762
Sequence CTTCTCTTGTTGGGGAAAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 305
Summary {0: 1, 1: 0, 2: 3, 3: 28, 4: 273}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079975309_1079975314 26 Left 1079975309 11:27083740-27083762 CCCTTTTTCCCCAACAAGAGAAG 0: 1
1: 0
2: 3
3: 28
4: 273
Right 1079975314 11:27083789-27083811 TGTAATCTCTTTGCATAGCAAGG 0: 1
1: 0
2: 2
3: 11
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079975309 Original CRISPR CTTCTCTTGTTGGGGAAAAA GGG (reversed) Intronic
900327230 1:2114328-2114350 CTTATTTTGTTGGACAAAAAAGG + Intronic
900942184 1:5806821-5806843 CTTCTCTTCTTGCTTAAAAAGGG + Intergenic
901624113 1:10613909-10613931 CTTCTCTAGCTGGGAAGAAAAGG - Intronic
901897291 1:12325030-12325052 CTTCTCTTTTTGAAGAGAAAGGG - Intronic
903097210 1:20989026-20989048 CCTCTCTTTTTGGGGGAATAGGG - Intronic
903634888 1:24805586-24805608 GTTCTCTTTCTGGAGAAAAAAGG + Intronic
907531016 1:55097089-55097111 CTTCTGAAGTTGGGGAAAATGGG - Exonic
907922711 1:58928562-58928584 CTTCTAGTCTTGGGGAAAAGGGG - Intergenic
909573237 1:77141969-77141991 CTTTTATTGTGGGGGAAAAATGG - Intronic
909573368 1:77143494-77143516 CTTTTATTATGGGGGAAAAATGG - Intronic
910736473 1:90463724-90463746 CTTCTCTTAGAAGGGAAAAAAGG + Intergenic
913469421 1:119174169-119174191 CTCCTTCTGATGGGGAAAAATGG + Intergenic
914217436 1:145644948-145644970 CTTCTCTAATTGAGGCAAAAGGG - Intronic
914439467 1:147691150-147691172 CTTCTCATTATGGGGGAAAAAGG - Intergenic
914470005 1:147967633-147967655 CTTCTCTAATTGAGGCAAAAGGG - Intronic
917279796 1:173369720-173369742 CTTCCTCTGATGGGGAAAAATGG + Intergenic
917327858 1:173851537-173851559 CTGCTGTTCTTGAGGAAAAAGGG - Intronic
917472818 1:175340521-175340543 CTTCTCTTGTCTGCAAAAAAAGG - Intronic
917643331 1:177005278-177005300 CCATTCTTGTTGGGGTAAAATGG - Intronic
918013649 1:180611213-180611235 CTGCTGTTGCTGGGGAAGAAAGG - Intergenic
918015143 1:180625891-180625913 TTTATCTTTTTGGGGAAACACGG - Intergenic
918101997 1:181384427-181384449 CCTATTTTATTGGGGAAAAATGG + Intergenic
919522441 1:198605425-198605447 TTTTCCTTATTGGGGAAAAAAGG + Intergenic
921788030 1:219256105-219256127 CTTCTATAGTAGAGGAAAAAAGG - Intergenic
922694879 1:227724917-227724939 TTTACCTTCTTGGGGAAAAAAGG - Intergenic
923031133 1:230249737-230249759 CTTCTCTAGCTGGGGAGAGAAGG + Intronic
923303022 1:232660652-232660674 TTTTTCTTGTGGGTGAAAAATGG + Intergenic
924275916 1:242386717-242386739 GTACTCTGGTTAGGGAAAAAAGG + Intronic
924615812 1:245610982-245611004 CTCCTCTTTTTGGGGAGAAAAGG - Intronic
1063635630 10:7779610-7779632 ACTCTATTGTTAGGGAAAAATGG - Intronic
1065220728 10:23493357-23493379 CTACTTTTGTTGGGGCTAAAAGG + Intergenic
1065739619 10:28785075-28785097 CTTCCCTTCTTGTGGGAAAAGGG + Intergenic
1065836880 10:29666379-29666401 CTTCTCTGCCTGGGGCAAAAAGG + Intronic
1067353037 10:45494497-45494519 GTTCTTTTGGTGGGGACAAAGGG - Intronic
1067801984 10:49365587-49365609 TTTCTCTTGTTGGAGAATATTGG - Exonic
1068213706 10:53955010-53955032 CCTCAGTTGTTGAGGAAAAAGGG - Intronic
1068219359 10:54024839-54024861 CCTCTTTTTTTGGTGAAAAAGGG - Intronic
1068430579 10:56926743-56926765 TGTCTCTTGTTGGGTAAAAATGG + Intergenic
1070069919 10:73078282-73078304 GTTCACTTGATGGGCAAAAATGG - Intronic
1070268216 10:74925411-74925433 CTTCACTTGTGGGGGGAAAAAGG - Intronic
1070803080 10:79254893-79254915 CCACTCTTGCTGGGGAAGAAGGG + Intronic
1074840229 10:117344333-117344355 CTGAGCTTGTTGGGGAAACAGGG - Intronic
1075154170 10:119960354-119960376 CTTCTCTGATTGTGGAGAAATGG + Intergenic
1075880323 10:125845605-125845627 CTGCTCTTATTGGGAAGAAAGGG - Intronic
1076079511 10:127565978-127566000 TTTCCCTTGCTGTGGAAAAATGG - Intergenic
1077348036 11:2073368-2073390 CGTCTCCTGTTGGGGACACAGGG + Intergenic
1078293573 11:10041944-10041966 CTACACTTTTTGGGGCAAAATGG + Intronic
1079240753 11:18720870-18720892 CTTCTGTCTGTGGGGAAAAAAGG + Intronic
1079975309 11:27083740-27083762 CTTCTCTTGTTGGGGAAAAAGGG - Intronic
1080907794 11:36564158-36564180 CTTCTCTTGTTTGAGGAATAAGG + Intronic
1081246178 11:40769951-40769973 TTTCTCTGGTTGGGGATATAAGG - Intronic
1081347749 11:42011131-42011153 GTTCTTTTATTGAGGAAAAAAGG - Intergenic
1083924388 11:65797251-65797273 CTTCTCTGCATGGGGAAAAAGGG - Intergenic
1086011486 11:82109128-82109150 CATATCTTTTTGGGGAAAAGTGG - Intergenic
1086944890 11:92835200-92835222 CTCCTATTCTTGGGGACAAATGG - Intronic
1087888970 11:103514909-103514931 TTTCTCTTTTTGCAGAAAAAGGG - Intergenic
1091252036 11:134152222-134152244 CATCCCTTCTTGGGAAAAAATGG - Intronic
1092343662 12:7697688-7697710 CTACTCTTATTGTTGAAAAAAGG - Intergenic
1092881071 12:12888223-12888245 CCTCTCTTTTTGGGGGAACATGG + Intergenic
1093012021 12:14117235-14117257 CTTCTCTAGTAGGGGAAAGGAGG - Intergenic
1096422866 12:51475188-51475210 CTACTCTGGTTGGGAAATAACGG - Exonic
1098050495 12:66447585-66447607 CTCCTGTAGTGGGGGAAAAAAGG - Intronic
1099041903 12:77666825-77666847 CTTGTCGTGTTGGGTAACAATGG + Intergenic
1099538730 12:83878101-83878123 CTTTTCTTGTTTGGGATGAAAGG - Intergenic
1099981155 12:89604835-89604857 GTTCTGTTGTTGGGGGGAAAGGG - Intronic
1101023878 12:100581653-100581675 GTTCTTTTGTTGGAGAAAAATGG + Intronic
1104566912 12:129893641-129893663 CTTCTGCTGAAGGGGAAAAATGG - Intronic
1105533455 13:21241961-21241983 CTTCTATTATTCAGGAAAAAAGG + Intergenic
1106400547 13:29425816-29425838 CTTCTCTTCTTGGGCACAGAGGG - Intronic
1106402117 13:29441190-29441212 CTTCTCCTGGTGGGGGAGAAGGG - Intronic
1106966445 13:35076632-35076654 TCTCTCTTGCTGTGGAAAAAAGG + Intronic
1108035558 13:46286846-46286868 CATTTCTTATTGGTGAAAAATGG - Intergenic
1108309017 13:49167229-49167251 CTTCTCCTCTGGGGAAAAAAGGG - Exonic
1108455769 13:50612090-50612112 TTTCTCTTGTTTGGGACATAGGG - Intronic
1108650393 13:52472625-52472647 CTTTTCTTTTTTGGGAGAAAGGG - Intronic
1108823877 13:54388184-54388206 CTAATCTTGTGGGGAAAAAAAGG - Intergenic
1109047070 13:57426088-57426110 CTTCTAGGGATGGGGAAAAATGG + Intergenic
1111754771 13:92379393-92379415 CCTCCATTGTTGGGGCAAAAAGG + Intronic
1111977207 13:94978682-94978704 GTTTTGTTGTTGGGAAAAAAGGG - Intergenic
1112259856 13:97868171-97868193 CTTGTCATGTTGGGAAACAAGGG + Intergenic
1116337775 14:43679918-43679940 CATCTGTTGTGGGGGAAAAAGGG + Intergenic
1116614703 14:47119748-47119770 ATTGTCTTGAAGGGGAAAAAAGG - Intronic
1117051818 14:51867801-51867823 GTTTTTTTATTGGGGAAAAAAGG - Intronic
1118137014 14:63040947-63040969 TTTTTCTTTTTGGGGAAAAAAGG - Intronic
1118664308 14:68050165-68050187 ATAATCTCGTTGGGGAAAAATGG - Intronic
1119711993 14:76829086-76829108 CTTCCCTTCTTGGGGAAACTGGG - Intronic
1122221583 14:100242207-100242229 CTTCTCTGGATGTGGAAAAGTGG - Intronic
1122465044 14:101927025-101927047 CTTCTCCTTTTGAGGGAAAAAGG + Exonic
1128559725 15:68656588-68656610 CTTCTCTTGGTGGGGGAAGGAGG - Intronic
1130746085 15:86655274-86655296 CTTCAATTGTTGGGGAACAATGG - Intronic
1131160001 15:90099461-90099483 CTTCTCTTTTTGGGGGGAGAAGG + Intronic
1133550178 16:6846989-6847011 GTGTTCTTGTTGGGGAAAAGGGG + Intronic
1133644398 16:7750290-7750312 GCTTTCTTGTTGAGGAAAAACGG - Intergenic
1136079718 16:27843913-27843935 CTTCCCTTGTAGGAGAGAAAGGG - Intronic
1137795153 16:51211047-51211069 CTGCTCTGGTAGGGGATAAAAGG + Intergenic
1137844050 16:51669501-51669523 TTTCTCTTATTGGGGAAGGAGGG + Intergenic
1138099442 16:54240680-54240702 CTTCTTTCCTTGGGGAATAATGG - Intergenic
1141694341 16:85612669-85612691 CTTTTCTAGTTGGGGTAATAAGG + Intronic
1141915669 16:87094886-87094908 AGTCTCTGGTTGGGGAAAATGGG - Intronic
1142756672 17:2020503-2020525 CTTCTCTTTTGTGGGAAGAAGGG - Intronic
1143747916 17:9006905-9006927 CTTCTCTTCTTAGGGAAGACAGG - Intergenic
1146114016 17:30117829-30117851 CTTCTCTTCTTTGATAAAAATGG + Intronic
1148085336 17:44990486-44990508 CTTTTCTTCTTGGGGTAGAAGGG - Intergenic
1149355047 17:55831048-55831070 CTTCTCCTATTTGGGCAAAAGGG - Intronic
1150937387 17:69651457-69651479 CTTTCCTTGTTGGGGTAGAATGG + Intergenic
1152888435 17:82866255-82866277 CTTCTCCTGCTCGGGATAAAGGG - Intronic
1153324907 18:3808690-3808712 CTTTTCTTGTTAGAGAAAGAGGG - Intronic
1153723165 18:7928058-7928080 CTTCTCTTTCTGGGGAAAATGGG + Intronic
1153862693 18:9229944-9229966 CTTCTCTGGTTGTGGAATCAGGG + Intronic
1153866332 18:9272894-9272916 CTTCTCCTGATGGAGAAAACAGG - Intronic
1155179739 18:23334096-23334118 CTTCTCCTGAAGGGGAGAAAAGG + Intronic
1155272867 18:24157840-24157862 CTTCTCTTTTTAGGGACAGAAGG + Intronic
1160619059 18:80157714-80157736 CTTCTCTTGCTTAGGAACAAAGG + Exonic
1160993816 19:1872760-1872782 CTTCTCTCGGTGGGGAAGCAGGG + Intergenic
1162709625 19:12582900-12582922 CTTGTATTTTAGGGGAAAAATGG - Exonic
1162782357 19:13012880-13012902 CTTCTCTTTTGGGGGAGTAAAGG + Intronic
1163593245 19:18205745-18205767 TTTCTCTTCCTGGGGAAAAAAGG - Intergenic
1164185891 19:22869324-22869346 CTACTCTTTTGGGGGAAAAATGG + Intergenic
1164623666 19:29713045-29713067 AGGCTCTTGTTGGGGAAGAAAGG + Intronic
1164760477 19:30724814-30724836 CTTCACTTGGTAGGAAAAAAGGG - Intergenic
1167780916 19:51598321-51598343 CTTCTCTTCTTGGTGCATAATGG + Intergenic
925283826 2:2703269-2703291 CTGCTCCTTTTGGGGCAAAAGGG - Intergenic
925600049 2:5598903-5598925 CTGCTTTTGTTGGTGAAACAAGG + Intergenic
925776899 2:7344503-7344525 CTCCCCTTCTTGGGGCAAAAGGG - Intergenic
926767485 2:16334989-16335011 CTTCCCATGTTGGAGAGAAATGG - Intergenic
926802486 2:16671354-16671376 CTTCTCTTTTTGGGGGAGAAAGG - Intergenic
928014373 2:27641598-27641620 CTTTTCTTGTTGTTGAGAAAGGG + Intronic
928783318 2:34850920-34850942 ATTCTCCTGCAGGGGAAAAAAGG + Intergenic
929122420 2:38494433-38494455 CCTCTCTGGTTGGGGAAAAGAGG - Intergenic
929832369 2:45357505-45357527 CTTTCTTTGTGGGGGAAAAATGG + Intergenic
931412856 2:62050488-62050510 TTGCTTTTGTTAGGGAAAAAGGG + Intronic
931686530 2:64798809-64798831 GTACTTTTTTTGGGGAAAAAAGG + Intergenic
932133275 2:69206490-69206512 CTTCCCTTGTTAGAGAAAGAAGG - Intronic
933420187 2:82035148-82035170 ATTCTTTTGTTGGGAAAAAAAGG + Intergenic
935468098 2:103423501-103423523 ATGCTATTTTTGGGGAAAAAAGG + Intergenic
935553079 2:104479018-104479040 CTGCTCATGTTGGGGAGAAATGG - Intergenic
935810593 2:106793459-106793481 CTACTCTGCTTGGGGAGAAAGGG + Intergenic
936505754 2:113104475-113104497 CTTCTCATGGTGGGGGCAAAAGG + Intergenic
937025994 2:118697680-118697702 ATTCTATTTTTGGGAAAAAATGG - Intergenic
939020334 2:136950850-136950872 ATTCTCTTGATGTGGAAGAAAGG + Intronic
940032017 2:149273667-149273689 CTTCTCTGGTAGGGGAAAGTGGG - Intergenic
941449862 2:165646831-165646853 CTTTTTTTATTGGGAAAAAAAGG - Intronic
941766445 2:169302381-169302403 ATTTTCTTGGTGGGGAAACAAGG - Intronic
942187504 2:173438362-173438384 TTTCCCTTTTTTGGGAAAAATGG - Intergenic
943498601 2:188656525-188656547 CTGGTCTTGTTGGCGAAAAGAGG + Intergenic
947082688 2:226416492-226416514 CTTCTCTTGTCGGTTACAAATGG - Intergenic
947888115 2:233592405-233592427 CTTCTCTTATTGGGGATATGGGG + Intergenic
947894343 2:233655635-233655657 CTTCTCTTGTAGGGGATATGGGG + Intronic
948092386 2:235305383-235305405 CTTGTCTTCTTGGGCAAAAGGGG + Intergenic
1169808901 20:9588973-9588995 CATCTCTTTTCGGGGAACAAGGG - Intronic
1170503975 20:17004826-17004848 CTTCTCTTTTTGAGAAAGAAGGG - Intergenic
1171130926 20:22652415-22652437 CATCTCTTGTTAGGAGAAAAGGG + Intergenic
1172003163 20:31797480-31797502 CTTCTCTTTCTTGGGAACAAAGG - Exonic
1173328078 20:42051635-42051657 CTTCTAATTTTGGGGAACAAGGG + Intergenic
1173919638 20:46733963-46733985 CTGCTTTTGCTGGGGTAAAAAGG + Exonic
1175377196 20:58536264-58536286 CTTCTCTGATTGGGGAAACCAGG + Intergenic
1177157565 21:17513983-17514005 TTTCTCTGGGAGGGGAAAAAAGG + Intronic
1177254873 21:18648439-18648461 TTGCTCTGGTTGGGAAAAAATGG - Intergenic
1178164129 21:29952571-29952593 TTTCTTTTGTTGGAGGAAAATGG - Intergenic
1179419935 21:41227400-41227422 CAGCTCTAGTTGGGGACAAAAGG + Intronic
1181259620 22:21588000-21588022 CTTCTCTTGATGGGGACAGCAGG - Intronic
1181471100 22:23140417-23140439 CCTCTGTAGTTGGGGAAAGATGG - Exonic
1181889100 22:26045972-26045994 CACCTCTCATTGGGGAAAAATGG + Intergenic
1185336556 22:50273156-50273178 TTTCTCTTGTGGGGGAGAGATGG + Intergenic
949672168 3:6411743-6411765 ACTCCCTTGCTGGGGAAAAAAGG + Intergenic
950197689 3:11020824-11020846 CAACTCTTTTTGGGGAGAAAAGG - Intronic
950863943 3:16174269-16174291 CTGCTCTTGTGGGAGAAGAAGGG + Intergenic
951296501 3:20942522-20942544 CTATTATTGTTGGGGAAAAGGGG + Intergenic
951616923 3:24557355-24557377 CTTATTTTGGAGGGGAAAAAGGG - Intergenic
952000370 3:28778299-28778321 CTTTTCTTAATGGGGCAAAAGGG + Intergenic
955028796 3:55196582-55196604 GTTCTCTTATTGAGAAAAAAAGG - Intergenic
955747775 3:62157049-62157071 CTTCTCTGTTTGGGGAAAAAGGG - Exonic
955814369 3:62826415-62826437 ATGTTATTGTTGGGGAAAAATGG + Intronic
956208325 3:66776880-66776902 CTACTCCTCTTGGGGGAAAATGG - Intergenic
956639773 3:71404764-71404786 CTTCTCTGTGTGGGGTAAAATGG - Intronic
957837631 3:85618260-85618282 TATCTTTTATTGGGGAAAAAAGG - Intronic
961986619 3:131141345-131141367 CTGCTCAGGATGGGGAAAAATGG + Intronic
962497995 3:135962029-135962051 CTTCTTTTTCTGGGGAAAAGGGG + Intergenic
964049800 3:152376837-152376859 TATCTCTTCTTGGGGAAAATGGG + Intronic
966956037 3:184880166-184880188 GTTCTCTTATTGGGGAAAATTGG - Intronic
967994124 3:195153993-195154015 CTTCTCAGGTGGGGGAACAAAGG + Intronic
968048290 3:195635929-195635951 CTTGTCTTGTCTGTGAAAAAGGG + Intergenic
968099114 3:195953691-195953713 CTTGTCTTGTCTGTGAAAAAGGG - Intergenic
968214965 3:196881462-196881484 ATTCTCTTGGTGGGGAAGAAGGG - Intronic
968278559 3:197458846-197458868 CTTTTCTTCCTGGGGAAAAAAGG - Intergenic
968306320 3:197653992-197654014 CTTGTCTTGTCTGTGAAAAAGGG - Intergenic
968924715 4:3541140-3541162 CATATCCTGTTGGGGAAAACTGG - Intergenic
969037112 4:4263388-4263410 CTTCCCTTGTTGAAGAAAATTGG - Intergenic
971138170 4:23892995-23893017 TTTCTATTGTTGAGAAAAAATGG - Intronic
971507725 4:27384554-27384576 CTTCTTTTGTTGGTGCAGAATGG + Intergenic
972227840 4:37034302-37034324 TTTCTCTTGTAGGGGCACAAAGG - Intergenic
972509397 4:39753342-39753364 CTTCTCTGGGGGGGAAAAAAGGG + Intronic
973174057 4:47182144-47182166 CTTGTCTTGTTGAGGTTAAAAGG + Intronic
974028714 4:56756833-56756855 GTTCCCTTGCTGGGGAGAAAAGG - Intergenic
974674261 4:65070327-65070349 TTTCTTTAGTTGGGGAAGAAAGG + Intergenic
975282684 4:72579812-72579834 CAACTCTTGTTTGGGAAAAACGG + Intergenic
975680678 4:76872753-76872775 CTTTACTTGTTAGAGAAAAATGG - Intergenic
976856089 4:89607249-89607271 CCTCTCTTCTTGGGGGAAACTGG + Intergenic
977313615 4:95417016-95417038 ATTCTCTTACTGGGGAGAAAAGG + Intronic
977701134 4:100024206-100024228 CTTCTCATGATGGGAAAAGAGGG + Intergenic
978410441 4:108419034-108419056 TTCCTCTTGTTGGGGATAGAAGG + Intergenic
978583095 4:110251814-110251836 CTTCTCTTGGCTTGGAAAAATGG + Intergenic
981410279 4:144422123-144422145 CTATTCTAGTTGGGGATAAAGGG + Intergenic
981457344 4:144968589-144968611 CTTCACTTGTTAGGGAAGAGGGG - Intronic
982956905 4:161781644-161781666 CTGCATGTGTTGGGGAAAAAGGG - Intronic
985504779 5:272420-272442 CTTGTCTTGTCTGTGAAAAAGGG + Intronic
985743335 5:1633175-1633197 CTTTTCTTGTCTGTGAAAAAGGG - Intergenic
988446398 5:31290661-31290683 GTTCTTTTCTTGGGAAAAAAAGG - Intronic
989000569 5:36756154-36756176 CTTCTCATTATGAGGAAAAAAGG + Intergenic
989107132 5:37873787-37873809 CTTCTCTGGTTGAAGCAAAATGG + Intergenic
990084716 5:51961144-51961166 CTTCTCTTGTCTGTTAAAAATGG - Intergenic
990388894 5:55298526-55298548 CATCTTTTTTGGGGGAAAAAAGG + Intronic
993043473 5:82841453-82841475 TTCCTCTTGTTGGGGAAGAGAGG + Intergenic
994953161 5:106491649-106491671 CTTTTCTTGTTGGGGAATCATGG - Intergenic
995540435 5:113180655-113180677 ATACTCTTCTTGGGCAAAAATGG - Intronic
996201468 5:120679995-120680017 CTGCTCTTGTTGGGGAGAAATGG + Intronic
996642363 5:125771159-125771181 CCTTTTTTGGTGGGGAAAAAAGG + Intergenic
997725139 5:136114017-136114039 CATGTCCTGTTAGGGAAAAAGGG - Intergenic
997932150 5:138081644-138081666 CCTCTCTGCTTGGGGAAAATAGG - Intergenic
998964824 5:147527790-147527812 CTTCCCTATTTGGGGAATAAGGG + Intergenic
999198017 5:149795970-149795992 CTTCTCTTATGTGGGAAAATGGG - Intronic
999420023 5:151432696-151432718 TTTCTCTGGTTGGGCAGAAAGGG + Intergenic
999936957 5:156497216-156497238 CTTCTGTTATTGAGGAAAGATGG + Intronic
1001218720 5:169880437-169880459 CTTCTCTTTTTGTTGAAAACTGG - Intronic
1003388804 6:5694385-5694407 CTTCTATTATTCAGGAAAAAAGG - Intronic
1004083193 6:12416528-12416550 CTTCTCTGGAAGGGGAACAAGGG + Intergenic
1004644612 6:17547923-17547945 CTTATTTTGTTGGGAAATAAGGG - Intronic
1005134485 6:22552048-22552070 ATTATCTTTTAGGGGAAAAATGG + Intergenic
1005742750 6:28808079-28808101 CATCTTTTGCTGGGGAAAATTGG - Intergenic
1008225982 6:48917432-48917454 TTTCCCTTGTTGTGGAAATAGGG - Intergenic
1008911746 6:56741002-56741024 ATTTTCTTCTTGGGTAAAAAAGG + Intronic
1009466743 6:63980205-63980227 CTTCACTTATTGGGGAAAATAGG + Intronic
1010211545 6:73366329-73366351 ATTTTGTTATTGGGGAAAAAGGG - Intergenic
1010693465 6:78940069-78940091 TTTCTCTTGTTTGGCAGAAATGG + Exonic
1014079300 6:117269434-117269456 CGTCTCTTAAGGGGGAAAAAAGG - Intronic
1015006773 6:128291882-128291904 CTACTCTTGTTGTAGAAAAAGGG + Intronic
1015401912 6:132796977-132796999 CTTACCTCTTTGGGGAAAAACGG + Exonic
1015984982 6:138875711-138875733 TTTCACTTGGTGGTGAAAAAAGG + Intronic
1016873230 6:148839237-148839259 CTCCTCTTGTTTAGGAAAACTGG - Intronic
1017531709 6:155299263-155299285 CTTCTCTTTGTGAGCAAAAAGGG + Intronic
1018342621 6:162867782-162867804 CTTCTCTTGCTGGAGAAAACCGG - Intronic
1019409930 7:901935-901957 CATCTCCTGCTGGGGGAAAAGGG - Intronic
1021386978 7:20043605-20043627 CTGCTCTTGTTGCAGCAAAATGG - Intergenic
1022321284 7:29290229-29290251 CATCTGTTGTTAGGGAATAAAGG - Intronic
1023925777 7:44668549-44668571 CCTCACTTGTTGAGGAGAAAGGG + Intronic
1024689316 7:51782018-51782040 CTTCTGAATTTGGGGAAAAAAGG + Intergenic
1027508605 7:79050717-79050739 ATTGTCTTGTGGGGTAAAAATGG - Intronic
1030529374 7:110693956-110693978 CTTCCCTTCTTGGGGAACAGAGG + Intronic
1030823835 7:114129982-114130004 CTTTTCTTGATGGGAAAAACAGG + Intronic
1030877316 7:114831226-114831248 CTGTTCTTGTTGGGAAAAATTGG + Intergenic
1030940467 7:115640718-115640740 CTGCTCTTTTTGGTTAAAAATGG - Intergenic
1031313681 7:120231099-120231121 CTTCTTTTATTGGGGGAAAGTGG - Intergenic
1031971067 7:128065587-128065609 CCTCTTTTCTTGGGGAAAATCGG - Intronic
1032063128 7:128741556-128741578 TTTCTCTTTTTGGACAAAAAGGG - Intronic
1032287697 7:130554561-130554583 CTACACTTGTTGGGCAAAGAGGG - Exonic
1032691468 7:134291553-134291575 CTTCTCTTCTTCTGGAAAGATGG - Exonic
1034096916 7:148417811-148417833 CTACTCATTTTGGGAAAAAAGGG - Exonic
1035475046 7:159137199-159137221 CTTCTCCTGTCTGGGAAGAACGG - Intronic
1035948247 8:3989555-3989577 CCTTTCTTGTTTGGGGAAAAAGG - Intronic
1036024769 8:4893858-4893880 TTTCTGTTTTTGGGGAAAAAAGG - Intronic
1036101420 8:5790660-5790682 CTTTTCTTTTTGTGGAAAACAGG + Intergenic
1037062192 8:14528227-14528249 CTTCTCAAGTTTGGGAAAGAAGG + Intronic
1039569046 8:38572289-38572311 CTTCACTTGTTGAAAAAAAAAGG + Intergenic
1040379284 8:46856645-46856667 CTTGTCTTGTTGCTGAACAACGG + Intergenic
1041377087 8:57215950-57215972 CTTCTCTTGTCGGGGAAGAGGGG + Intergenic
1042231486 8:66559530-66559552 CTTCTCTGGATGTGGAAACAGGG - Intergenic
1043427724 8:80165170-80165192 CTTGTCTTATAGGGGAAAAATGG - Intronic
1044078613 8:87856070-87856092 CCTCTGTTCTTGGGGAAAACAGG - Intergenic
1044454103 8:92371909-92371931 CTTCTCTTGTTTTTGAAAGAGGG - Intergenic
1044733588 8:95254267-95254289 TTTCACTTGTTGGTGGAAAAGGG - Intronic
1045853056 8:106726250-106726272 CGTCTCTGGTATGGGAAAAAAGG + Intronic
1046486433 8:114894393-114894415 CTCCACTTGTTGGGGAATAGGGG + Intergenic
1046821821 8:118642202-118642224 CATCTCTTCTTGGGAACAAAGGG - Intergenic
1047371537 8:124260082-124260104 TTTCTATGTTTGGGGAAAAAGGG + Intergenic
1048383757 8:133892326-133892348 CATCTGTTGTTGGGGAAAAAAGG + Intergenic
1048982643 8:139711215-139711237 CTTTCCTTGTTGGTGAAACAAGG + Intergenic
1049437012 8:142591224-142591246 CTTTTCTTGCTGGTGAGAAATGG - Intergenic
1050518613 9:6472849-6472871 TTTTTCTGGTTGGGGGAAAAAGG + Intronic
1053799787 9:41757107-41757129 CATATCCTGTTGGGGAAAACTGG - Intergenic
1054188195 9:61969162-61969184 CATATCCTGTTGGGGAAAACTGG - Intergenic
1054650319 9:67619414-67619436 CATATCCTGTTGGGGAAAACTGG + Intergenic
1054861391 9:69957400-69957422 CTTCTCTTGCTGGTGAAGAGAGG + Intergenic
1054863623 9:69977788-69977810 CTTCCCAGGTTGGAGAAAAATGG + Intergenic
1057841277 9:98487320-98487342 CCTATCTGGTTGGGAAAAAAGGG + Intronic
1058253288 9:102729297-102729319 TTTCTCTTGTTGCCGAAAACAGG - Intergenic
1059083218 9:111272314-111272336 CAACTCATGATGGGGAAAAAAGG - Intergenic
1059221108 9:112619545-112619567 CTTTTCTTTTTGGGGGGAAAGGG + Intronic
1059686417 9:116641431-116641453 GTTTTCATGTTGGGGAAAAAAGG + Intronic
1060755250 9:126207927-126207949 CTTCTCTCTATGGGGACAAAGGG + Intergenic
1187108134 X:16266554-16266576 CTTCTCTCTGTGGGGAGAAAGGG - Intergenic
1187368394 X:18683388-18683410 CTTGTCTTATTGAGGAAAAGAGG - Intronic
1188097403 X:26041980-26042002 ATTCTCTCTCTGGGGAAAAATGG + Intergenic
1188549700 X:31349648-31349670 CTATTCTTGGTGGGGAAGAAAGG + Intronic
1189230683 X:39450442-39450464 CTTCACTCGTTGGGGAGGAAGGG - Intergenic
1189582235 X:42418891-42418913 ACTGTCATGTTGGGGAAAAATGG + Intergenic
1189923936 X:45933035-45933057 ATTCTCTTGTTGGGAAAATGAGG + Intergenic
1190107455 X:47570417-47570439 GTTCTGTTTCTGGGGAAAAATGG - Intronic
1191756573 X:64599068-64599090 CTTCTTATGTTGGGGCATAAAGG - Intergenic
1192047609 X:67692743-67692765 CTTCTTTTGTGGATGAAAAATGG + Intronic
1192070643 X:67936838-67936860 CTTGTCTTTTTGATGAAAAAGGG + Intergenic
1195770368 X:108344802-108344824 CTGCTCTTGATGGAGGAAAATGG - Intronic
1197164584 X:123362575-123362597 CTTCTGTTGCTGTTGAAAAAAGG - Intronic
1197448078 X:126577312-126577334 ATTCTCTAGTTGTTGAAAAAAGG - Intergenic
1198301959 X:135342422-135342444 TTTCTCTTGTTGGGTCCAAATGG - Exonic
1201272035 Y:12264838-12264860 CTCTCCTTGATGGGGAAAAATGG - Intergenic