ID: 1079983668

View in Genome Browser
Species Human (GRCh38)
Location 11:27178073-27178095
Sequence CATTCTGCACTGAGGGCTAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079983662_1079983668 16 Left 1079983662 11:27178034-27178056 CCAACTTAGTCTTCAAGCTTAAG No data
Right 1079983668 11:27178073-27178095 CATTCTGCACTGAGGGCTATTGG No data
1079983661_1079983668 17 Left 1079983661 11:27178033-27178055 CCCAACTTAGTCTTCAAGCTTAA No data
Right 1079983668 11:27178073-27178095 CATTCTGCACTGAGGGCTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079983668 Original CRISPR CATTCTGCACTGAGGGCTAT TGG Intergenic
No off target data available for this crispr