ID: 1079983668 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 11:27178073-27178095 |
| Sequence | CATTCTGCACTGAGGGCTAT TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1079983662_1079983668 | 16 | Left | 1079983662 | 11:27178034-27178056 | CCAACTTAGTCTTCAAGCTTAAG | No data | ||
| Right | 1079983668 | 11:27178073-27178095 | CATTCTGCACTGAGGGCTATTGG | No data | ||||
| 1079983661_1079983668 | 17 | Left | 1079983661 | 11:27178033-27178055 | CCCAACTTAGTCTTCAAGCTTAA | No data | ||
| Right | 1079983668 | 11:27178073-27178095 | CATTCTGCACTGAGGGCTATTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1079983668 | Original CRISPR | CATTCTGCACTGAGGGCTAT TGG | Intergenic | ||
| No off target data available for this crispr | |||||