ID: 1079983840

View in Genome Browser
Species Human (GRCh38)
Location 11:27179556-27179578
Sequence AGGCAGGACTCATTTTTGCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079983840_1079983847 14 Left 1079983840 11:27179556-27179578 CCGAGCAAAAATGAGTCCTGCCT No data
Right 1079983847 11:27179593-27179615 AGAGACTTCCACATTGCTGTTGG No data
1079983840_1079983843 -9 Left 1079983840 11:27179556-27179578 CCGAGCAAAAATGAGTCCTGCCT No data
Right 1079983843 11:27179570-27179592 GTCCTGCCTCAGGGTACCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079983840 Original CRISPR AGGCAGGACTCATTTTTGCT CGG (reversed) Intergenic
No off target data available for this crispr