ID: 1079983844

View in Genome Browser
Species Human (GRCh38)
Location 11:27179572-27179594
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079983844_1079983847 -2 Left 1079983844 11:27179572-27179594 CCTGCCTCAGGGTACCTCTGGAG No data
Right 1079983847 11:27179593-27179615 AGAGACTTCCACATTGCTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079983844 Original CRISPR CTCCAGAGGTACCCTGAGGC AGG (reversed) Intergenic
No off target data available for this crispr