ID: 1079983847

View in Genome Browser
Species Human (GRCh38)
Location 11:27179593-27179615
Sequence AGAGACTTCCACATTGCTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079983844_1079983847 -2 Left 1079983844 11:27179572-27179594 CCTGCCTCAGGGTACCTCTGGAG No data
Right 1079983847 11:27179593-27179615 AGAGACTTCCACATTGCTGTTGG No data
1079983845_1079983847 -6 Left 1079983845 11:27179576-27179598 CCTCAGGGTACCTCTGGAGAGAC No data
Right 1079983847 11:27179593-27179615 AGAGACTTCCACATTGCTGTTGG No data
1079983840_1079983847 14 Left 1079983840 11:27179556-27179578 CCGAGCAAAAATGAGTCCTGCCT No data
Right 1079983847 11:27179593-27179615 AGAGACTTCCACATTGCTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079983847 Original CRISPR AGAGACTTCCACATTGCTGT TGG Intergenic
No off target data available for this crispr