ID: 1079987829

View in Genome Browser
Species Human (GRCh38)
Location 11:27216800-27216822
Sequence TGGCCTTGGTCACAAGACAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079987829_1079987838 17 Left 1079987829 11:27216800-27216822 CCCTTGTCTTGTGACCAAGGCCA No data
Right 1079987838 11:27216840-27216862 GCACAAAATTGGCTGGAGGCAGG No data
1079987829_1079987832 -5 Left 1079987829 11:27216800-27216822 CCCTTGTCTTGTGACCAAGGCCA No data
Right 1079987832 11:27216818-27216840 GGCCACCAACACTGTCACTGAGG No data
1079987829_1079987837 13 Left 1079987829 11:27216800-27216822 CCCTTGTCTTGTGACCAAGGCCA No data
Right 1079987837 11:27216836-27216858 TGAGGCACAAAATTGGCTGGAGG No data
1079987829_1079987835 6 Left 1079987829 11:27216800-27216822 CCCTTGTCTTGTGACCAAGGCCA No data
Right 1079987835 11:27216829-27216851 CTGTCACTGAGGCACAAAATTGG No data
1079987829_1079987836 10 Left 1079987829 11:27216800-27216822 CCCTTGTCTTGTGACCAAGGCCA No data
Right 1079987836 11:27216833-27216855 CACTGAGGCACAAAATTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079987829 Original CRISPR TGGCCTTGGTCACAAGACAA GGG (reversed) Intergenic