ID: 1079992230

View in Genome Browser
Species Human (GRCh38)
Location 11:27258223-27258245
Sequence CTCATTCAGCACCTATTGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079992230_1079992234 0 Left 1079992230 11:27258223-27258245 CCAATCAATAGGTGCTGAATGAG No data
Right 1079992234 11:27258246-27258268 TGGGTTTGCAGAACTAGGTGAGG No data
1079992230_1079992233 -5 Left 1079992230 11:27258223-27258245 CCAATCAATAGGTGCTGAATGAG No data
Right 1079992233 11:27258241-27258263 ATGAGTGGGTTTGCAGAACTAGG No data
1079992230_1079992235 22 Left 1079992230 11:27258223-27258245 CCAATCAATAGGTGCTGAATGAG No data
Right 1079992235 11:27258268-27258290 GCATAATTTGAACTTATAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079992230 Original CRISPR CTCATTCAGCACCTATTGAT TGG (reversed) Intergenic
No off target data available for this crispr