ID: 1079992234

View in Genome Browser
Species Human (GRCh38)
Location 11:27258246-27258268
Sequence TGGGTTTGCAGAACTAGGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079992227_1079992234 19 Left 1079992227 11:27258204-27258226 CCTGGCACAAAGACAGTGCCCAA No data
Right 1079992234 11:27258246-27258268 TGGGTTTGCAGAACTAGGTGAGG No data
1079992230_1079992234 0 Left 1079992230 11:27258223-27258245 CCAATCAATAGGTGCTGAATGAG No data
Right 1079992234 11:27258246-27258268 TGGGTTTGCAGAACTAGGTGAGG No data
1079992226_1079992234 27 Left 1079992226 11:27258196-27258218 CCACAGTGCCTGGCACAAAGACA No data
Right 1079992234 11:27258246-27258268 TGGGTTTGCAGAACTAGGTGAGG No data
1079992229_1079992234 1 Left 1079992229 11:27258222-27258244 CCCAATCAATAGGTGCTGAATGA No data
Right 1079992234 11:27258246-27258268 TGGGTTTGCAGAACTAGGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079992234 Original CRISPR TGGGTTTGCAGAACTAGGTG AGG Intergenic
No off target data available for this crispr