ID: 1079994165

View in Genome Browser
Species Human (GRCh38)
Location 11:27277874-27277896
Sequence TTGAGGCACTAAGTTTGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079994165_1079994170 9 Left 1079994165 11:27277874-27277896 CCTCCCCAAACTTAGTGCCTCAA No data
Right 1079994170 11:27277906-27277928 TATTAACCCTCTTTGTTCTGTGG No data
1079994165_1079994174 19 Left 1079994165 11:27277874-27277896 CCTCCCCAAACTTAGTGCCTCAA No data
Right 1079994174 11:27277916-27277938 CTTTGTTCTGTGGATTGACTGGG No data
1079994165_1079994175 28 Left 1079994165 11:27277874-27277896 CCTCCCCAAACTTAGTGCCTCAA No data
Right 1079994175 11:27277925-27277947 GTGGATTGACTGGGATTCACTGG No data
1079994165_1079994173 18 Left 1079994165 11:27277874-27277896 CCTCCCCAAACTTAGTGCCTCAA No data
Right 1079994173 11:27277915-27277937 TCTTTGTTCTGTGGATTGACTGG No data
1079994165_1079994176 29 Left 1079994165 11:27277874-27277896 CCTCCCCAAACTTAGTGCCTCAA No data
Right 1079994176 11:27277926-27277948 TGGATTGACTGGGATTCACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079994165 Original CRISPR TTGAGGCACTAAGTTTGGGG AGG (reversed) Intergenic
No off target data available for this crispr