ID: 1079994168

View in Genome Browser
Species Human (GRCh38)
Location 11:27277879-27277901
Sequence ATGTTTTGAGGCACTAAGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079994168_1079994173 13 Left 1079994168 11:27277879-27277901 CCAAACTTAGTGCCTCAAAACAT No data
Right 1079994173 11:27277915-27277937 TCTTTGTTCTGTGGATTGACTGG No data
1079994168_1079994170 4 Left 1079994168 11:27277879-27277901 CCAAACTTAGTGCCTCAAAACAT No data
Right 1079994170 11:27277906-27277928 TATTAACCCTCTTTGTTCTGTGG No data
1079994168_1079994174 14 Left 1079994168 11:27277879-27277901 CCAAACTTAGTGCCTCAAAACAT No data
Right 1079994174 11:27277916-27277938 CTTTGTTCTGTGGATTGACTGGG No data
1079994168_1079994176 24 Left 1079994168 11:27277879-27277901 CCAAACTTAGTGCCTCAAAACAT No data
Right 1079994176 11:27277926-27277948 TGGATTGACTGGGATTCACTGGG No data
1079994168_1079994175 23 Left 1079994168 11:27277879-27277901 CCAAACTTAGTGCCTCAAAACAT No data
Right 1079994175 11:27277925-27277947 GTGGATTGACTGGGATTCACTGG No data
1079994168_1079994177 27 Left 1079994168 11:27277879-27277901 CCAAACTTAGTGCCTCAAAACAT No data
Right 1079994177 11:27277929-27277951 ATTGACTGGGATTCACTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079994168 Original CRISPR ATGTTTTGAGGCACTAAGTT TGG (reversed) Intergenic
No off target data available for this crispr