ID: 1079994169

View in Genome Browser
Species Human (GRCh38)
Location 11:27277891-27277913
Sequence GGTTAATAATAAATGTTTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079994169_1079994174 2 Left 1079994169 11:27277891-27277913 CCTCAAAACATTTATTATTAACC No data
Right 1079994174 11:27277916-27277938 CTTTGTTCTGTGGATTGACTGGG No data
1079994169_1079994177 15 Left 1079994169 11:27277891-27277913 CCTCAAAACATTTATTATTAACC No data
Right 1079994177 11:27277929-27277951 ATTGACTGGGATTCACTGGGTGG No data
1079994169_1079994180 28 Left 1079994169 11:27277891-27277913 CCTCAAAACATTTATTATTAACC No data
Right 1079994180 11:27277942-27277964 CACTGGGTGGTTCTCATTTGGGG No data
1079994169_1079994179 27 Left 1079994169 11:27277891-27277913 CCTCAAAACATTTATTATTAACC No data
Right 1079994179 11:27277941-27277963 TCACTGGGTGGTTCTCATTTGGG No data
1079994169_1079994170 -8 Left 1079994169 11:27277891-27277913 CCTCAAAACATTTATTATTAACC No data
Right 1079994170 11:27277906-27277928 TATTAACCCTCTTTGTTCTGTGG No data
1079994169_1079994176 12 Left 1079994169 11:27277891-27277913 CCTCAAAACATTTATTATTAACC No data
Right 1079994176 11:27277926-27277948 TGGATTGACTGGGATTCACTGGG No data
1079994169_1079994178 26 Left 1079994169 11:27277891-27277913 CCTCAAAACATTTATTATTAACC No data
Right 1079994178 11:27277940-27277962 TTCACTGGGTGGTTCTCATTTGG No data
1079994169_1079994173 1 Left 1079994169 11:27277891-27277913 CCTCAAAACATTTATTATTAACC No data
Right 1079994173 11:27277915-27277937 TCTTTGTTCTGTGGATTGACTGG No data
1079994169_1079994175 11 Left 1079994169 11:27277891-27277913 CCTCAAAACATTTATTATTAACC No data
Right 1079994175 11:27277925-27277947 GTGGATTGACTGGGATTCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079994169 Original CRISPR GGTTAATAATAAATGTTTTG AGG (reversed) Intergenic
No off target data available for this crispr