ID: 1079994175

View in Genome Browser
Species Human (GRCh38)
Location 11:27277925-27277947
Sequence GTGGATTGACTGGGATTCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079994169_1079994175 11 Left 1079994169 11:27277891-27277913 CCTCAAAACATTTATTATTAACC No data
Right 1079994175 11:27277925-27277947 GTGGATTGACTGGGATTCACTGG No data
1079994166_1079994175 25 Left 1079994166 11:27277877-27277899 CCCCAAACTTAGTGCCTCAAAAC No data
Right 1079994175 11:27277925-27277947 GTGGATTGACTGGGATTCACTGG No data
1079994171_1079994175 -10 Left 1079994171 11:27277912-27277934 CCCTCTTTGTTCTGTGGATTGAC No data
Right 1079994175 11:27277925-27277947 GTGGATTGACTGGGATTCACTGG No data
1079994167_1079994175 24 Left 1079994167 11:27277878-27277900 CCCAAACTTAGTGCCTCAAAACA No data
Right 1079994175 11:27277925-27277947 GTGGATTGACTGGGATTCACTGG No data
1079994165_1079994175 28 Left 1079994165 11:27277874-27277896 CCTCCCCAAACTTAGTGCCTCAA No data
Right 1079994175 11:27277925-27277947 GTGGATTGACTGGGATTCACTGG No data
1079994168_1079994175 23 Left 1079994168 11:27277879-27277901 CCAAACTTAGTGCCTCAAAACAT No data
Right 1079994175 11:27277925-27277947 GTGGATTGACTGGGATTCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079994175 Original CRISPR GTGGATTGACTGGGATTCAC TGG Intergenic
No off target data available for this crispr