ID: 1080002086

View in Genome Browser
Species Human (GRCh38)
Location 11:27361741-27361763
Sequence TGAACACCCTGTACTGAAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 89}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080002080_1080002086 4 Left 1080002080 11:27361714-27361736 CCATATTCCATTCACTCATGCTG 0: 1
1: 0
2: 1
3: 17
4: 197
Right 1080002086 11:27361741-27361763 TGAACACCCTGTACTGAAGGGGG 0: 1
1: 0
2: 0
3: 6
4: 89
1080002082_1080002086 -3 Left 1080002082 11:27361721-27361743 CCATTCACTCATGCTGGATATGA 0: 1
1: 0
2: 1
3: 11
4: 153
Right 1080002086 11:27361741-27361763 TGAACACCCTGTACTGAAGGGGG 0: 1
1: 0
2: 0
3: 6
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080002086 Original CRISPR TGAACACCCTGTACTGAAGG GGG Intronic
900498858 1:2989903-2989925 TTAAGACCCTGTGCTCAAGGAGG - Intergenic
903322723 1:22552479-22552501 TGATCACCCCTTAATGAAGGAGG - Intergenic
908685673 1:66716628-66716650 AGAACACCCTGAACGGAAGATGG - Intronic
913190451 1:116408832-116408854 TCAACACTCCCTACTGAAGGAGG + Intronic
915759350 1:158295266-158295288 TGCAGACCCTGGGCTGAAGGGGG + Intergenic
918857363 1:189775302-189775324 TGATCAGCATGTATTGAAGGAGG - Intergenic
921154471 1:212428262-212428284 TGAACAGGCTTTACTAAAGGAGG - Intergenic
1063641531 10:7835638-7835660 TGTACTCCCTGTACTGGAAGTGG + Intronic
1070440301 10:76436447-76436469 TGAACAGCCTGACCTGCAGGTGG - Intronic
1073727882 10:106255557-106255579 TGAACATGCTGTGCTGAATGTGG + Intergenic
1073890652 10:108097068-108097090 GGCACACCCTGACCTGAAGGTGG + Intergenic
1075375446 10:121974889-121974911 TGAGCGCCCGGTACTGATGGCGG + Exonic
1075647623 10:124107059-124107081 TGAACACTCTGTTCTGAAACTGG - Intergenic
1076323954 10:129606327-129606349 TTAACACCGTGTACTGAAGTGGG + Intronic
1077905641 11:6530732-6530754 TGAACCCCCTGTACAAGAGGAGG - Intronic
1080002086 11:27361741-27361763 TGAACACCCTGTACTGAAGGGGG + Intronic
1080958764 11:37132966-37132988 GGAACACCTTGAACTGAATGAGG + Intergenic
1082896643 11:58198576-58198598 TGAAAAATCTGTTCTGAAGGAGG + Intergenic
1084339014 11:68480828-68480850 TGAACACTCCATATTGAAGGAGG - Intronic
1084778233 11:71391330-71391352 CGAACACCCTGTAAGGAAGAAGG - Intergenic
1086661210 11:89420894-89420916 AGAACACACTGTACACAAGGAGG - Intronic
1090616322 11:128518822-128518844 TGTACACCCTCTGCTGAGGGCGG + Intronic
1100466615 12:94851289-94851311 TGAACACCATTTATTGAATGGGG - Intergenic
1100825829 12:98473347-98473369 AGAACACCCTGTGATGATGGAGG + Intergenic
1111842633 13:93469850-93469872 TGAACACCATTTACTGAAAAGGG + Intronic
1112332420 13:98486571-98486593 TGAACACCCTGCAGTGCATGGGG - Intronic
1113097128 13:106677952-106677974 TGACCAGCCAGTGCTGAAGGGGG - Intergenic
1115010315 14:28537668-28537690 TGCAGACCCTGGACTGAAAGGGG - Intergenic
1116902630 14:50376448-50376470 TGAACATCCTGTAATAGAGGAGG + Intronic
1120040039 14:79742375-79742397 TTAACTCCTTGTACTGAATGAGG + Intronic
1122106615 14:99462025-99462047 TGAACACCCTGCAAGGAGGGAGG + Intronic
1133616602 16:7482838-7482860 TGAACACCATGTACAGGAGATGG + Intronic
1136057643 16:27702243-27702265 TTAACACCCTGTGCTGCATGGGG - Intronic
1142694690 17:1627436-1627458 GGAACACCCTGGACAGCAGGTGG + Intronic
1152676623 17:81644735-81644757 TCATCACCCTGTTCTAAAGGTGG + Intronic
1156033969 18:32745902-32745924 TGAACTAACTGTGCTGAAGGGGG + Intronic
1158236273 18:55318980-55319002 TGAACTCCCTGAACTGAGAGAGG - Intronic
1162332504 19:10038916-10038938 TGAACACCCGGTAGTGAACTAGG - Intergenic
1162573793 19:11487150-11487172 TGTCCACCCTGTAGAGAAGGAGG - Exonic
1163075458 19:14887016-14887038 TGATGACCCTGTAGTGCAGGGGG + Intergenic
925298195 2:2792255-2792277 TGAACCCAATGTAGTGAAGGTGG + Intergenic
925496011 2:4449938-4449960 TGATCACCCTGTTATGCAGGTGG - Intergenic
936672730 2:114677120-114677142 TGAAAACACTGGGCTGAAGGAGG - Intronic
941662715 2:168211785-168211807 TGAACGCCCTGTGCAGAAAGAGG - Intronic
946142698 2:217705148-217705170 TGAAAAGACTGGACTGAAGGGGG + Intronic
947778016 2:232730249-232730271 TGGGCACCCTGTGCTGAAAGAGG + Intronic
1175019246 20:55826796-55826818 TGAAGACCCTGTGCTGAGGGAGG + Intergenic
1176248673 20:64109688-64109710 GGAACACCCTGCTCTGAAGAAGG - Intergenic
1178472629 21:32907022-32907044 TGAATGCCCTGTAGTGAAGAAGG + Intergenic
1182037811 22:27213276-27213298 TGATCACCATATAATGAAGGTGG + Intergenic
1182327651 22:29525831-29525853 TCAATACCCTGCACTGATGGGGG + Exonic
950063229 3:10089780-10089802 TGAGCACCCTGTTCTCAAGATGG - Intronic
950927947 3:16761332-16761354 TGAACACCCAGGACAGGAGGTGG - Intergenic
958875438 3:99611030-99611052 TAAACACCATTTACTGAATGAGG + Intergenic
959948303 3:112150142-112150164 TGAACACCCTGTTCTGGAGCAGG - Intronic
964784670 3:160382541-160382563 TAATCACCCTGTCCTGATGGAGG - Intronic
967912819 3:194556219-194556241 GCAAAACCCTGTACTGCAGGTGG - Intergenic
968122662 3:196136726-196136748 GCAACACTCTGTCCTGAAGGGGG - Intergenic
969697815 4:8745095-8745117 TTAACAGTCTGTAATGAAGGCGG - Intergenic
975722354 4:77260733-77260755 GGAACTCCCTGTACTGAGTGAGG - Intronic
977020359 4:91751379-91751401 TGCCCATCCTGTTCTGAAGGAGG + Intergenic
980455040 4:133028500-133028522 TGATCACCGTGTATTGAAGATGG - Intergenic
986558891 5:9040665-9040687 TGAAGATCCTGTAGTGAGGGAGG + Exonic
988389694 5:30611861-30611883 TGATCATCCTGGATTGAAGGTGG + Intergenic
988665524 5:33323223-33323245 TGAATACCCTGTAAACAAGGTGG + Intergenic
992218886 5:74552181-74552203 TGAAGACTCTGCACTGAATGGGG + Intergenic
997234605 5:132265583-132265605 TTAAAACCCTCAACTGAAGGGGG + Intronic
997588665 5:135059816-135059838 TGAATACCCTGGCATGAAGGGGG - Intronic
1005980168 6:30830491-30830513 TAAGCACACTGGACTGAAGGAGG - Intergenic
1006656808 6:35602082-35602104 AGAACACCCTGTTCTGAATGTGG + Intronic
1007433015 6:41787277-41787299 AGAACGCGCAGTACTGAAGGGGG - Exonic
1008068138 6:47072374-47072396 TGAACACCCTTTGCTGGAGAGGG + Intergenic
1015014330 6:128392338-128392360 TGAAAACACTAGACTGAAGGTGG + Intronic
1017035529 6:150263754-150263776 TGAGCTCCCTGTACTGCATGAGG + Intergenic
1019186947 6:170226129-170226151 TGAATGCCCGGTACTGCAGGAGG + Intergenic
1021007595 7:15418601-15418623 TGAACAGCATATACTGAAGGGGG + Exonic
1022200573 7:28113074-28113096 TGAATGCCCTGAACTGGAGGCGG - Intronic
1030514075 7:110519446-110519468 GGACCTCCCTGGACTGAAGGTGG + Intergenic
1033112240 7:138590430-138590452 AGAACACCCTGGGCTGAATGTGG - Intergenic
1033480833 7:141738585-141738607 TGGACACCCTTTACCGAAGATGG - Exonic
1033555321 7:142483975-142483997 TGGACACCCTGCGCTGACGGTGG + Intergenic
1038092870 8:24273921-24273943 TGAACACACTGTACTCAGTGGGG + Intergenic
1039618789 8:38977955-38977977 TGAACTTCCTGTACTGATGCTGG + Exonic
1039671996 8:39612280-39612302 TGTAGACCCTGTGCTGAATGGGG + Intronic
1044039847 8:87354085-87354107 GGACCACCCTGAACTGAAGTTGG + Intronic
1048174746 8:132141361-132141383 TTAAGAGCCTGCACTGAAGGAGG - Intronic
1059410768 9:114130893-114130915 TAAACAACCAGTACTGGAGGGGG - Intergenic
1061133804 9:128722227-128722249 GGAGCACCCTGGACTGAGGGCGG + Intronic
1186411894 X:9351373-9351395 TGAACCACCTGTACTGAACTTGG + Intergenic
1187408451 X:19025192-19025214 TGCAACCCCTGCACTGAAGGTGG - Intronic
1190376997 X:49797712-49797734 ACAACACCTTGTCCTGAAGGTGG - Intergenic
1192866816 X:75142684-75142706 TGACCTCCTTGGACTGAAGGTGG + Intronic
1192932680 X:75824577-75824599 TGCAGACCCTGGACTGAAGGGGG - Intergenic
1195294698 X:103464522-103464544 TGAACACCCTGCTCTCCAGGAGG - Intergenic
1195655010 X:107324891-107324913 GGCACACCCTGTCCTGAAGATGG - Intergenic
1199569686 X:149254945-149254967 TGCACTCCCTGTTCTCAAGGAGG - Intergenic