ID: 1080002819

View in Genome Browser
Species Human (GRCh38)
Location 11:27370295-27370317
Sequence TTCTCTTAGCACTTCCTGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 296
Summary {0: 1, 1: 0, 2: 4, 3: 18, 4: 273}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080002819_1080002823 28 Left 1080002819 11:27370295-27370317 CCCTTCAGGAAGTGCTAAGAGAA 0: 1
1: 0
2: 4
3: 18
4: 273
Right 1080002823 11:27370346-27370368 CTAAACTCATCCTTCATGGAAGG 0: 1
1: 0
2: 2
3: 13
4: 128
1080002819_1080002822 24 Left 1080002819 11:27370295-27370317 CCCTTCAGGAAGTGCTAAGAGAA 0: 1
1: 0
2: 4
3: 18
4: 273
Right 1080002822 11:27370342-27370364 TTATCTAAACTCATCCTTCATGG 0: 1
1: 0
2: 0
3: 17
4: 223

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080002819 Original CRISPR TTCTCTTAGCACTTCCTGAA GGG (reversed) Intronic
905157391 1:35996836-35996858 TTCTTTTTGAATTTCCTGAACGG - Intronic
906478433 1:46185204-46185226 TGCTCTTTTCTCTTCCTGAAGGG + Exonic
906803953 1:48761727-48761749 TTCTCTAAGTACATCCTAAAGGG + Intronic
908423339 1:63980955-63980977 TCCTCTTAGCACTTTGTGCAAGG + Intronic
908611815 1:65869416-65869438 TTGTTGTAGCATTTCCTGAAAGG + Intronic
910152432 1:84166990-84167012 TTCTGTTTTCACTTCCTGTATGG - Intronic
910715193 1:90222876-90222898 ATCTCCTAACACTACCTGAAGGG + Intergenic
910885936 1:91963538-91963560 TTCTCTTGACACTTCCTGGCAGG + Intronic
912839985 1:113030765-113030787 TTCCCTAAGCACATCTTGAATGG - Intergenic
913481219 1:119291130-119291152 TTCTGGTAGTACTCCCTGAAGGG - Intergenic
915040245 1:152962311-152962333 TACTCTTAGCACTTCAGAAATGG - Intergenic
915861385 1:159448770-159448792 TTATTTTAGCATTTCTTGAATGG - Intergenic
916368354 1:164060334-164060356 TTCTCTTAGCTCATCCCTAAGGG + Intergenic
916827294 1:168454531-168454553 TGCAGTTAGCACTTCCAGAAAGG + Intergenic
916831939 1:168502406-168502428 TTCACTTAGCAGGTCCTCAATGG - Intergenic
917024466 1:170627062-170627084 TTCTTTTAACATTTCCTGCAAGG + Intergenic
917988310 1:180345489-180345511 TTCACTTAGCATTTCTAGAAAGG + Intronic
919697105 1:200588600-200588622 TTCTATTAGCGGTTCTTGAAGGG - Intronic
919811165 1:201409675-201409697 TTCTCTCAGCACTTCCGTAGAGG + Intronic
921558736 1:216630845-216630867 TTCTCTTTTCATTTTCTGAAAGG - Intronic
921686414 1:218094089-218094111 TTCTCTTAACAGTGTCTGAAGGG - Intergenic
923541590 1:234892041-234892063 TGCGCTTAACACTTACTGAATGG + Intergenic
924211993 1:241779024-241779046 TTCTTTTAACATTTCTTGAAAGG + Intronic
924846188 1:247774891-247774913 TTCTCTCAGCACTTACACAATGG + Intergenic
1063324909 10:5088958-5088980 TCCTCTGAGCATTTCCTGAAGGG + Intronic
1065365664 10:24934451-24934473 TTCTATCAGCAATTCCTAAAGGG - Intronic
1066082411 10:31944600-31944622 TTCTGTAGCCACTTCCTGAAAGG - Intergenic
1067205094 10:44206378-44206400 TTCTGCAAGCACTTACTGAAGGG - Intergenic
1070048952 10:72867940-72867962 TTCCCTTAGCACTTACTAAGGGG + Intronic
1070892673 10:79953286-79953308 TTCCTTTAGCACTTCTTGCAAGG + Intronic
1071173599 10:82897948-82897970 TTCACTTAGCACTTACTATAAGG + Intronic
1076206766 10:128610082-128610104 TTCTCTTTTCATTTCCTCAAAGG + Intergenic
1076775322 10:132692776-132692798 TTCTTTTAGCATTTCTTGCAAGG - Intronic
1077945642 11:6894937-6894959 TTGTCTTTTCACTTCCTTAATGG - Intergenic
1078538444 11:12193975-12193997 TTTTCTTAGGAGTTCCTGCAAGG + Intronic
1080002819 11:27370295-27370317 TTCTCTTAGCACTTCCTGAAGGG - Intronic
1081416076 11:42817813-42817835 TTCTCTTAGCAATTCTTGAATGG - Intergenic
1081462181 11:43282178-43282200 TTCTCTCAGCATCTCCAGAAAGG + Intergenic
1081667326 11:44924176-44924198 CTCTCTTAGCATATCCTGAGTGG - Intronic
1084230843 11:67751490-67751512 TTCTCCTCTCACTTCCTAAAAGG - Intergenic
1084993876 11:72956068-72956090 TTCTCTGAGCACTTCCTCTCTGG - Intronic
1085864413 11:80272329-80272351 TTCCCTTTGCACTTCTTGTAAGG - Intergenic
1085972719 11:81612385-81612407 TTCTCAAAGCAGATCCTGAAGGG + Intergenic
1086158344 11:83693402-83693424 TTCATTTGGCCCTTCCTGAAGGG - Intronic
1086363612 11:86085814-86085836 TTCTTTTAGCATTTCTTGCAGGG + Intergenic
1087586981 11:100134278-100134300 TTCTGTAAGCACATCCTCAAGGG - Intronic
1088300272 11:108350805-108350827 TGCTTTTAGCACGACCTGAATGG - Intronic
1088753505 11:112865848-112865870 TTCTCTTAGGACATCCTCCAGGG + Intergenic
1090284053 11:125483708-125483730 TTCTGTGGGCACTTCCTGCAGGG - Intronic
1090595701 11:128319013-128319035 ATCGCATACCACTTCCTGAAGGG - Intergenic
1090881479 11:130835423-130835445 TTCTCTTTGCACTGCCTTCACGG + Intergenic
1091455370 12:603368-603390 TTCTCTTTTCACTTCCTTGATGG + Intronic
1092824267 12:12383163-12383185 TTTTCTTAGCAGTTGCTGTAGGG + Intronic
1095913501 12:47452840-47452862 TTTTCATATCACTTCCTGAGTGG + Intergenic
1095943820 12:47742447-47742469 ATCTCTCCCCACTTCCTGAAGGG + Intronic
1096104394 12:48988131-48988153 TTCTCTCAGGACTTGCTGGAAGG + Intergenic
1096762910 12:53858243-53858265 TTGTCTTCTCACTTCCTCAATGG - Intergenic
1097189950 12:57214825-57214847 TTCTCCTAGCAGGTCCTGACAGG - Intergenic
1099397547 12:82159424-82159446 TTTTCCTAGCACCTCCAGAATGG + Intergenic
1099727833 12:86456853-86456875 TTCTGATAGCCCTTCCTGACAGG - Intronic
1100876805 12:98970760-98970782 ATCTGTTACTACTTCCTGAAAGG + Intronic
1101024145 12:100584263-100584285 TTCTAGTAGCCCTTCCTGATTGG - Intronic
1105383756 13:19911476-19911498 TTCTTTTAGCCTTTCCCGAAGGG + Intergenic
1106161960 13:27209374-27209396 TCCTTTTAGCATTTCCTGTAGGG - Intergenic
1107160702 13:37223954-37223976 TTCTTTTAGCATTTCTTGCAAGG + Intergenic
1107508699 13:41060800-41060822 TTCTCATAGCACTTCCCATATGG - Intronic
1107565564 13:41600389-41600411 CTTTCTTAGCACATCATGAATGG - Intronic
1109649463 13:65307596-65307618 TTCTCATATCACCTCATGAAAGG + Intergenic
1109893747 13:68654822-68654844 TTCTCCTAGCAGTTCCTTCAGGG - Intergenic
1110704549 13:78589487-78589509 TTATCTTTGCTCTTCATGAAAGG + Intergenic
1110705066 13:78595933-78595955 TTCTCTCAGAACGTCCTCAAGGG + Intergenic
1112915921 13:104550321-104550343 TTCCCTTTGCTCTTCCTGATTGG - Intergenic
1115672717 14:35632981-35633003 TTCCCTTTGGACTTCCTCAAAGG - Intronic
1116797152 14:49403808-49403830 TTCTCTTATCAGTACTTGAAAGG - Intergenic
1118464923 14:66022408-66022430 TGTTCTTTGCATTTCCTGAATGG + Intergenic
1118768874 14:68928679-68928701 TTCACTGAGCACTTACTAAATGG - Intronic
1119117577 14:72040285-72040307 TTCCATTAGCATTTCCTGTAAGG + Intronic
1120122799 14:80701977-80701999 CTCCCCTGGCACTTCCTGAATGG + Intronic
1121170013 14:91845827-91845849 TTCTCTAATTACTTCCTCAATGG + Intronic
1202867250 14_GL000225v1_random:129505-129527 TGCTCTTAGCTCTGCCTAAAGGG + Intergenic
1125145303 15:36460442-36460464 GCCTCTTAGCAGTTCCTTAAAGG - Intergenic
1125623745 15:41088578-41088600 TTTACTTACCACTTCCTGGATGG - Intronic
1126302744 15:47218000-47218022 TTTTCTGAGCACTTCTTGATTGG + Intronic
1126998331 15:54472524-54472546 TGCTCTTAGCATTTCTTCAAAGG + Intronic
1128225823 15:66000684-66000706 TTCTCTAACCATTTCCTGTATGG - Intronic
1128495631 15:68196893-68196915 TGCTCTAAGCTCTTCCAGAAAGG - Intronic
1129564005 15:76602277-76602299 TTCTTTTAACATTTCCTGCAAGG + Intronic
1129873485 15:78956834-78956856 TACTCTTTGCTCTTCCTGAGGGG - Intergenic
1133843620 16:9433682-9433704 TTCTTTAAGCACTTCTTGTAAGG + Intergenic
1133900932 16:9973896-9973918 TTCCTTTAGCATTTCTTGAAGGG - Intronic
1135068094 16:19328355-19328377 TTCTTTTAGCATTTCTTGCAGGG + Intergenic
1137730850 16:50688395-50688417 TCTTCTGAGCACTTCCTGCACGG + Intergenic
1138192955 16:55031598-55031620 CTGTCATAGCACTTGCTGAATGG - Intergenic
1138419356 16:56889213-56889235 TTCTGTTAGCACCTGCTGAGAGG - Intronic
1138593339 16:58015447-58015469 TTCTCTGAGCACTTCTGAAAGGG + Intronic
1141768090 16:86071875-86071897 TTCTCTATGGACTTCCTGTAAGG + Intergenic
1142527265 17:552517-552539 TACTGTTAGAACTTCCTGGACGG + Intronic
1144217670 17:13070678-13070700 TTTTCCTAGAACTTCCAGAAAGG + Intergenic
1146560961 17:33870251-33870273 TTGTCTAAGCACTTCATCAAAGG + Intronic
1149500028 17:57145637-57145659 TTCTCTTAACATCTTCTGAACGG + Intergenic
1150494898 17:65599940-65599962 TTCTCTGAGCACCTCCTGAAGGG + Intronic
1153016503 18:586865-586887 TTCTCTTAACATTTCTTGCAAGG + Intergenic
1153749914 18:8218776-8218798 TTCTCTTGGCAGTTCTTGCATGG + Intronic
1155720647 18:29007638-29007660 TTCTATTAACACTTTCAGAATGG - Intergenic
1159733926 18:72070295-72070317 TTTTGTTAGCATTTCCTGCAGGG + Intergenic
1160253308 18:77223302-77223324 GTCTCTAAGGACTTCCTGGAAGG - Intergenic
1160626373 18:80210205-80210227 ATCTCCAAGCACTTCCAGAATGG + Intronic
1165913018 19:39241103-39241125 TTCTCTCAGCACCTCATGTAGGG - Intergenic
1165985187 19:39762469-39762491 TCCACTTAGCTGTTCCTGAACGG - Intergenic
1167713779 19:51127874-51127896 TTCTCCTCCCACTTCCTGTAGGG - Intronic
925758568 2:7160355-7160377 TTCTTTTACCACTTCTTGCAAGG + Intergenic
926478834 2:13360984-13361006 TTCTTTTAGCATTTCTTGTAGGG - Intergenic
927258144 2:21058906-21058928 TTGCCTTTGAACTTCCTGAATGG + Intergenic
928479957 2:31673312-31673334 TTCTTTTAGCATTTCTTGTAGGG + Intergenic
930145630 2:48000631-48000653 TTCTTTTAGCATTTCTTGTAGGG - Intergenic
932602911 2:73142096-73142118 TTCTCTTAGAATTTCCTGTTTGG + Intronic
933452109 2:82467632-82467654 TTCTCCTAGCTCCTCCAGAAGGG + Intergenic
933536015 2:83575678-83575700 TTCTCTTTGAACTTCCTGGCTGG - Intergenic
935610486 2:105018953-105018975 TCCTTTTAGCAGTTCTTGAAGGG - Intergenic
935940348 2:108231008-108231030 TTCTCTTCCCAGTCCCTGAATGG - Intergenic
936292978 2:111241399-111241421 TTCCTTTAGTATTTCCTGAAGGG + Intergenic
939631199 2:144528394-144528416 TTCTGTTAGCACTTGTTGACTGG + Intergenic
940895083 2:159073759-159073781 TTCTATTTGCACTTCCTAGAAGG + Intronic
941202521 2:162529434-162529456 TTCTCTAAACATTTCTTGAAGGG - Intronic
942095166 2:172530389-172530411 TTCTCTCAGCAATTCCTTCAGGG + Intergenic
942711029 2:178836811-178836833 TTCTGTGAGCACTAACTGAAAGG - Intronic
943822460 2:192343888-192343910 TTCTTTTAACACCTCCTGTAAGG + Intergenic
945725480 2:213468166-213468188 TTCTCTTAGCCTCTCCAGAAAGG + Intronic
946384399 2:219373789-219373811 TTCTCTTTGCAGCTCCTGAGAGG + Exonic
947248207 2:228073547-228073569 GTCTTTTAGCCCTTCCTGAGAGG - Intronic
947802304 2:232937535-232937557 TTCTGTTAGCACTGCCTGCACGG + Intronic
1169151074 20:3289970-3289992 TCTTCTGAGCACTTCCTGTATGG - Intronic
1169509510 20:6248617-6248639 TTCTTTTAGTATTTCCTGAAAGG + Intergenic
1170161336 20:13314608-13314630 TTCTTTTAGCATTTCTTGCAAGG - Intergenic
1170790749 20:19507545-19507567 TTGTCTCAGCATTTCTTGAAAGG - Intronic
1171284986 20:23929625-23929647 TCCTTTTAGCAATTCCTGACTGG - Intergenic
1173801769 20:45898643-45898665 TTCCCGCAGCAGTTCCTGAATGG + Exonic
1175324211 20:58111188-58111210 CTCTTTGAGCACTACCTGAAGGG + Intergenic
1178132211 21:29586458-29586480 TTCTCTTAGAAATTCCTGGAGGG + Intronic
1178422270 21:32452231-32452253 ATATCTTAGTGCTTCCTGAAGGG + Intronic
1178428862 21:32501730-32501752 TTCTCCTCTCACTTCCTAAAAGG + Intronic
1181420818 22:22797174-22797196 TTTTCTCAGCACTGCCTGGAAGG - Intronic
1182658268 22:31906728-31906750 TGCTCTGAGCACTTGCTGACAGG - Exonic
1184972654 22:48037531-48037553 TTTTCTTTGCACCTCCAGAATGG - Intergenic
949631308 3:5929688-5929710 TTCTTTTTGCAATTCCTGTAAGG + Intergenic
949914796 3:8951469-8951491 TTCTTTTAGCATTTCTTGCAAGG - Intronic
950652986 3:14419220-14419242 TTGGCTTAACACTTTCTGAAAGG + Intronic
951692255 3:25408647-25408669 TTCCCTTAGCAATTCTTTAATGG - Intronic
951831088 3:26928123-26928145 TTCTCCTATCACTTTCTGCAGGG + Intergenic
953330195 3:42046373-42046395 GTCTCTTAGGAGTTCCTGAACGG - Intronic
953463777 3:43102333-43102355 TTCTCTTAGCCTTTTCAGAATGG + Intronic
955809563 3:62772509-62772531 TGCTCTTAGCCTTTCCTGGATGG - Intronic
955837972 3:63078684-63078706 TTCTTTTAGCTCTGCCTGCATGG + Intergenic
957047402 3:75386558-75386580 TTCTCCTCTCACTTCCTAAAAGG - Intergenic
957979950 3:87495802-87495824 TTCTCTCACCATTTGCTGAAGGG + Intergenic
959130353 3:102347776-102347798 GTTTCTTAGGACTTCCTGATAGG - Intronic
959855166 3:111145341-111145363 TTCGGTTACCACTTCATGAAAGG - Intronic
959989302 3:112612933-112612955 TTCTGGTAGCTCTTCCTGGATGG + Intronic
960085845 3:113590310-113590332 TTCTCTTATTACTTCCAGATGGG - Intronic
960749774 3:120935526-120935548 TTCTTTTAGCATTTCTTGCAAGG + Intronic
961328058 3:126122168-126122190 TTCTTTTAGTATTTCCTGTAAGG - Intronic
961879476 3:130050669-130050691 TTCTCCTCTCACTTCCTAAAAGG - Intergenic
963073219 3:141322224-141322246 TTCACTTAGCTCTTCCTAATGGG - Intergenic
963923869 3:150931073-150931095 ATCTCTTAGCAGTCACTGAAAGG - Intronic
964008378 3:151859218-151859240 TTCTCTTAGCACTTTTTAATAGG - Intergenic
965327683 3:167328000-167328022 TTGACTTAACACTTCCTGAAAGG + Exonic
968867057 4:3219909-3219931 TTCTCCCAGCACTCCCTGAGTGG + Intronic
968991686 4:3917573-3917595 TTCTCCTCTCACTTCCTAAAAGG - Intergenic
969294274 4:6260304-6260326 TTCTCTTGGCACTTTCTCTAGGG - Intergenic
971329933 4:25673995-25674017 TGCTCTCAGCACTTTCTGGAAGG + Intronic
971511302 4:27428571-27428593 TCCTGTTTGTACTTCCTGAAAGG + Intergenic
972364338 4:38360213-38360235 TTCTCTTGGCAGATCCTGAATGG + Intergenic
974267212 4:59601008-59601030 TTCTCTTAGCACTGCTTTCACGG - Intergenic
974573945 4:63691717-63691739 ATCTTTTAGTATTTCCTGAAGGG - Intergenic
974694179 4:65343863-65343885 TTTTCTTTAAACTTCCTGAAAGG + Intronic
975899826 4:79138845-79138867 TTCTTTTAGGACTTCTTGTAGGG + Intergenic
976347223 4:84018400-84018422 TTCCCTTATCTCTTCTTGAAAGG - Intergenic
976790028 4:88868203-88868225 TGGTCTTAGCACTTCATGAGCGG + Intronic
976871116 4:89795036-89795058 TTGTCATATCACTTCCTGAAAGG + Intronic
977634568 4:99282403-99282425 TTCCTTTAGCACCTCCTGGATGG + Exonic
977637261 4:99313878-99313900 TTCCTTTAGCACTTCCTGAATGG + Exonic
977639674 4:99342852-99342874 TTCCTTTAGCACTTCCTGAATGG + Exonic
978738493 4:112111542-112111564 TTCCCACAGCATTTCCTGAAGGG + Intergenic
979734408 4:124064762-124064784 CTTTCTTAGCATTTGCTGAAAGG + Intergenic
980017291 4:127665496-127665518 TTCTTTTACCTCTTCCTGAAAGG + Intronic
980153394 4:129076560-129076582 GTCTCTTGGTACTTGCTGAAGGG - Intronic
980224759 4:129967556-129967578 CTCTGTTAGGACTTCCTGAGAGG - Intergenic
980624524 4:135357241-135357263 TCTCCTTAGCACTTCCAGAAAGG - Intergenic
980711247 4:136571362-136571384 TTCTCATATCACTCCATGAATGG + Intergenic
980894923 4:138852973-138852995 TTCCCCTAGCACTTCCTAACAGG + Intergenic
980943824 4:139300352-139300374 TTCTCTTAACTGTCCCTGAAAGG - Intronic
981162470 4:141514925-141514947 TTTTCTTACCATTTCATGAAGGG - Intergenic
982383689 4:154777285-154777307 CTCTCTTAGCACTCCATGGATGG - Intergenic
983351439 4:166595579-166595601 CTCTCTTAGCATTTCTTGTAAGG - Intergenic
985368218 4:189256616-189256638 TGATATTAGCATTTCCTGAAAGG - Intergenic
986250340 5:6051163-6051185 TTCTCTTAGCAGTTCGTGTAGGG + Intergenic
986915944 5:12621208-12621230 TCCTTTTAGCATTTCCTGTAGGG + Intergenic
987490168 5:18569991-18570013 TTCTATTAGCATTCACTGAATGG - Intergenic
987723440 5:21666717-21666739 TTCTTTTAGCACATCTTGCAGGG + Intergenic
990244046 5:53844974-53844996 TTCTTTTAACATTTCCTGTAAGG - Intergenic
993453109 5:88096665-88096687 TTGTTTTAGCACTTCCAAAAAGG + Intergenic
993610510 5:90047811-90047833 TTTTCTTACCACTTCCTTTATGG + Intergenic
993622397 5:90184182-90184204 CTCTCTAAGCACTTTCTAAATGG - Intergenic
994500088 5:100564461-100564483 TTCTTTTGCCACTTTCTGAAAGG - Intronic
994888892 5:105603483-105603505 TCCTTTTAGCACTTCTTGTAGGG + Intergenic
995000720 5:107124696-107124718 TTCTTTAAGCACTTACTAAAAGG + Intergenic
998802665 5:145886201-145886223 TTCTCTAAGCTCTGCCTCAAGGG + Intergenic
999687172 5:154113383-154113405 TTCCCCTAGAACTTCCAGAAGGG + Intronic
1000604035 5:163309121-163309143 TTCTCTTACTACTTCTTTAACGG - Intergenic
1001935827 5:175704469-175704491 ATCTCTGAGCACATTCTGAATGG + Intergenic
1004179692 6:13370473-13370495 TTTGCTTAGCAATTCGTGAAGGG - Intronic
1008219731 6:48841338-48841360 TTCCCTTACCATTTGCTGAAAGG + Intergenic
1008510700 6:52273200-52273222 TTCTCATAACTCTTCCTCAAGGG - Intronic
1009034788 6:58103548-58103570 TTCTTTTAACATTTCTTGAAGGG - Intergenic
1009783384 6:68298739-68298761 TCCTTTTAGCATTTCCTGTAGGG - Intergenic
1010488495 6:76446192-76446214 TTCCTTTAGCAATTCCTGTAAGG + Intergenic
1010502030 6:76612624-76612646 GTTTCTGTGCACTTCCTGAAAGG + Intergenic
1011205370 6:84889094-84889116 TCCCCATAGCAATTCCTGAAGGG - Intergenic
1013837565 6:114350586-114350608 CTCTCTTAACTCTTCCTGGATGG + Intergenic
1015038296 6:128685060-128685082 TCCTTTTAGCACTTCTTGCATGG + Intergenic
1016266732 6:142241277-142241299 TTCTCTTTTGACTTCTTGAAAGG - Intergenic
1017892972 6:158654539-158654561 TACTCTTGGGCCTTCCTGAAGGG + Intronic
1018262535 6:161984780-161984802 TGCTGTTAGCATTTCATGAAGGG + Intronic
1018866570 6:167751139-167751161 TTCCCAAAGCACTTCCTGAAAGG - Intergenic
1019073557 6:169369111-169369133 TTCATTTAACACTTACTGAAGGG - Intergenic
1019226791 6:170518328-170518350 TTCTCTTAGCACTTGCTGGTTGG - Intergenic
1019264362 7:104775-104797 TTATCTTTGCACTTTCTTAATGG - Intergenic
1020314492 7:6895356-6895378 TTCTCCTCTCACTTCCTAAAAGG - Intergenic
1021323587 7:19240554-19240576 TCCTTTTAGCACTTCTTGTAGGG + Intergenic
1021360584 7:19707925-19707947 TTCACATAGGAATTCCTGAAGGG + Intronic
1021396743 7:20158672-20158694 TTGTCTTAGCACTGCCTTCAGGG + Exonic
1021889622 7:25174694-25174716 TTCTCAAGGCACTTCCTTAATGG + Intronic
1023345101 7:39263893-39263915 TTCTATCAGCACTTATTGAAAGG - Intronic
1023796188 7:43794307-43794329 TTCCTTTAGCATTTCCTGTAGGG - Intronic
1024041625 7:45560244-45560266 GTCTCTCAGCACTTCCACAAAGG + Intergenic
1024316448 7:48022989-48023011 TCCCTTTAGCACTTCCTGAAGGG - Intronic
1026962433 7:74417373-74417395 TTCTCTTTGCTCTGCCTGAGAGG + Intergenic
1027827332 7:83132970-83132992 TTCTCTTAGGACTTCATGAGTGG - Intronic
1028540020 7:91932676-91932698 TTCTCTAAGCACTTCCAAGATGG + Intergenic
1029178357 7:98681642-98681664 ATCTTTAAGCACTTCCTGGATGG + Intergenic
1029340333 7:99938293-99938315 TTCTCTTAGTATTTTCTGTAGGG + Intergenic
1030688001 7:112506229-112506251 TTCTCTGAGAAGTACCTGAATGG + Intergenic
1030911620 7:115257177-115257199 TTTTTTCAGCACTTCCTGATCGG - Intergenic
1031899570 7:127393535-127393557 TTCTCTTAAAATTTCCTGACGGG - Intronic
1032809937 7:135402855-135402877 TTCTTTTACTACTTCCTTAATGG + Intronic
1033035477 7:137872376-137872398 CTCTCTTCCCACTACCTGAAAGG - Intergenic
1034748900 7:153550090-153550112 TTTTATTAGCATTTCCTGAGAGG + Intergenic
1035573068 8:686975-686997 TTCTCTTAGCCTTTCCAGAGTGG - Intronic
1038641591 8:29333482-29333504 TTCTCTTGGGAGTTCCTGAGTGG - Exonic
1039037208 8:33372803-33372825 TTCTCTTTTCTCTTCCTGCAGGG - Exonic
1039129361 8:34245179-34245201 TCCTCTTAGCACTTTCTACAAGG + Intergenic
1039465351 8:37781519-37781541 CTCGCTTACCAATTCCTGAAGGG + Intergenic
1039869083 8:41530048-41530070 TTCTCTCACCACTTGCTAAAGGG + Intronic
1041131769 8:54709352-54709374 TTCTGTTTTCCCTTCCTGAAGGG + Intergenic
1042766703 8:72330181-72330203 GTCTCTTAGCATATCCTGCATGG - Intergenic
1042778169 8:72458826-72458848 TTCTTTTAACACTTCTTGCAAGG + Intergenic
1043232653 8:77822343-77822365 TTCTCTTAGCCTTCCCTAAAGGG - Intergenic
1044256415 8:90068527-90068549 TTCTCTCAACTCTTCCTCAATGG + Intronic
1044543869 8:93437325-93437347 TTCTCTTGGCTCTTCCTGGAAGG + Intergenic
1045903945 8:107320103-107320125 TACTTTTTTCACTTCCTGAATGG + Intronic
1046138760 8:110062943-110062965 TTCTCTTAGCCTTTCCAGAAAGG - Intergenic
1048049898 8:130806841-130806863 TTCTCTCTGCTCTTCCTGAGGGG - Intronic
1048079415 8:131109096-131109118 CTCTATTAGCACTTGCTGCATGG + Intergenic
1048485204 8:134841449-134841471 TTCTCCTCTCACTTTCTGAATGG + Intergenic
1050057979 9:1675620-1675642 TTTTCTCAGCACATCCCGAACGG - Intergenic
1050943762 9:11491865-11491887 TTCTCCCAGCACTTCTAGAAAGG - Intergenic
1051195102 9:14555644-14555666 TTCAGTTATCACTTCCTGGAGGG - Intergenic
1052584956 9:30415006-30415028 TTCCCACAGCACATCCTGAAGGG - Intergenic
1052844796 9:33325775-33325797 TTCTTTTAGTACTTACTGTAAGG - Intronic
1053184270 9:36002232-36002254 TTCCCTTAGCCCCTGCTGAAAGG - Intergenic
1053278552 9:36801467-36801489 TTCTCTTTGCTCTTCCTGGGTGG - Intergenic
1055905044 9:81283812-81283834 CTTCCTTAGCATTTCCTGAAAGG - Intergenic
1056088039 9:83174103-83174125 TTGTCTTATCACTTCCTTAATGG + Intergenic
1056876256 9:90334375-90334397 TTCTGTCAACACTTCTTGAAGGG - Intergenic
1057369088 9:94453693-94453715 CTCTGCTGGCACTTCCTGAAAGG - Intronic
1058849471 9:108996942-108996964 TTATCTTTGTACTTCCTGGAAGG - Intronic
1060649408 9:125312524-125312546 TTCTGGTTGCACCTCCTGAATGG - Exonic
1060783662 9:126432308-126432330 TGCTCTTAGCACTTCTTCAGAGG + Intronic
1186797472 X:13061116-13061138 TTCTCTTAGCATAACCTTAAGGG - Intergenic
1186876195 X:13820447-13820469 TGCTCTTAGGACATCCTGCAGGG + Intronic
1187531525 X:20101081-20101103 CTCCCTTAGCACATCCTGAAAGG + Intronic
1187643873 X:21325169-21325191 TTCTTTTAACATTTCTTGAAAGG + Intergenic
1189099934 X:38178427-38178449 TTCTAATAGCACCTCCTGCATGG - Intronic
1189724641 X:43955767-43955789 ATCTCCTAGCAATTCCGGAAAGG - Intronic
1194368646 X:93041943-93041965 TTCTTTGAGCATTTCCTGTATGG + Intergenic
1194509596 X:94777118-94777140 TTCTTTTAGCACTTACTTCATGG + Intergenic
1194754930 X:97727696-97727718 CTCTCGTAGAACTTCCAGAAAGG + Intergenic
1195930264 X:110067502-110067524 TTGTCTTTGCACTTCCCAAAGGG + Intronic
1196417311 X:115485174-115485196 TTGTCTTTGCACTTCCTTGATGG - Intergenic
1196520832 X:116668736-116668758 ATCTCTTAGCGTTTCCAGAAAGG - Intergenic
1197935345 X:131734726-131734748 TTCTCTGAGCACTACCTGTTGGG - Intergenic
1198175090 X:134146997-134147019 TTCTCTTAACAGGTCCTAAAGGG - Intergenic
1199550601 X:149057130-149057152 TTTTCTTGGAACTTCCTCAAAGG - Intergenic
1200064780 X:153499111-153499133 TGCTCTTAGAACTTGATGAAGGG - Intronic
1200663421 Y:5989918-5989940 ATCTCTTAGAATTTCCTGTAGGG - Intergenic
1201376670 Y:13330407-13330429 GGCTCTTTGCACTTCCTGAGTGG - Intronic