ID: 1080006517

View in Genome Browser
Species Human (GRCh38)
Location 11:27413623-27413645
Sequence GAAAGTCCCAGCATGCGCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 118}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080006507_1080006517 26 Left 1080006507 11:27413574-27413596 CCACTTGACATCAGCACCATGAA 0: 1
1: 0
2: 0
3: 11
4: 164
Right 1080006517 11:27413623-27413645 GAAAGTCCCAGCATGCGCTGGGG 0: 1
1: 0
2: 1
3: 8
4: 118
1080006509_1080006517 10 Left 1080006509 11:27413590-27413612 CCATGAAAGACAGGTTAAAACAG 0: 1
1: 0
2: 6
3: 27
4: 289
Right 1080006517 11:27413623-27413645 GAAAGTCCCAGCATGCGCTGGGG 0: 1
1: 0
2: 1
3: 8
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080006517 Original CRISPR GAAAGTCCCAGCATGCGCTG GGG Intronic
900385106 1:2406944-2406966 GACCCTCCCAGCAGGCGCTGAGG - Exonic
904688883 1:32279138-32279160 GAAAGTTCCAGCATGCCCATGGG + Intronic
909450223 1:75790194-75790216 GGAACTTCCAGCATGCACTGTGG + Intronic
911027213 1:93448270-93448292 GAAAGTTCCGCCATGAGCTGGGG + Exonic
911853629 1:102850960-102850982 GAAAGTCCCAGCATCTTCAGTGG - Intergenic
912748738 1:112268083-112268105 GACAGGCCCAGCATCTGCTGGGG - Intergenic
913187337 1:116380880-116380902 GAAAGTCACAGCAAGGGCAGGGG - Intronic
915141611 1:153771732-153771754 GAGAGACCCAGCATGCCCTGCGG + Intronic
919856224 1:201708182-201708204 CATAGTCCCAGCATGCACTGGGG - Intronic
920318339 1:205096606-205096628 GAAATTACCAGGTTGCGCTGGGG + Intronic
920693313 1:208163363-208163385 AAAAGTCTCAGCCTGGGCTGGGG + Intronic
921164455 1:212496548-212496570 GAAAGTCCCTACCTGCTCTGGGG + Intergenic
922551144 1:226495490-226495512 GTAAGTCCCAGGAGGAGCTGGGG - Intergenic
923437426 1:233980465-233980487 GAAAGTCCCTGCAAGGGATGTGG - Intronic
1064153678 10:12886299-12886321 GAAGCTCCAAGCATGGGCTGAGG + Intergenic
1070695834 10:78562372-78562394 GAAACTCTCAGGATGCACTGTGG - Intergenic
1071494769 10:86160654-86160676 GAAGGCCACAGCATGTGCTGAGG + Intronic
1074097273 10:110325187-110325209 GAAGGGCACAGCATGAGCTGGGG - Intergenic
1080006517 11:27413623-27413645 GAAAGTCCCAGCATGCGCTGGGG + Intronic
1085181894 11:74543238-74543260 GAAATGCCCAGCATGTGCTCAGG + Intronic
1087047140 11:93851524-93851546 GAGAGGCCCAGCATGCTCTGGGG + Intergenic
1093714000 12:22360931-22360953 GGAAGTCCAAGCTCGCGCTGTGG + Intronic
1093823132 12:23646452-23646474 GAAATTCCCACCAGGCGCGGTGG - Intronic
1093946928 12:25120091-25120113 TAAGGTCCCAGCCTGAGCTGGGG - Intronic
1096111792 12:49033291-49033313 GCAGGGCCCAGCATGCCCTGGGG + Exonic
1101285014 12:103302425-103302447 GGCAGTCCCAGCAGGCGCTCAGG - Exonic
1102340359 12:112116688-112116710 AAATGTCCCAGCATGCTCTGAGG + Intergenic
1103792335 12:123480536-123480558 GATAGTCTCTGCATGGGCTGAGG - Intronic
1112797979 13:103078173-103078195 GGAAGTCCCATCATGAGCTACGG + Intergenic
1114209640 14:20604057-20604079 GGAAGTGCCAGCATGTGCTCAGG + Intronic
1119544135 14:75459563-75459585 CACACTCCCAGCATGCTCTGGGG - Intronic
1121665746 14:95670840-95670862 GAAAGTCCCAGTAAGAGATGAGG - Intergenic
1122321852 14:100860163-100860185 GAAAGCACCAGCCTGCTCTGGGG + Intergenic
1122371383 14:101230576-101230598 GCAAGTCCCTGCATGGGATGAGG - Intergenic
1122977711 14:105177760-105177782 GAATGTCCCAGGATGGGCGGAGG + Intronic
1123882865 15:24691567-24691589 GAGAGTCCCAGGCTGCACTGTGG - Intergenic
1126040831 15:44589298-44589320 GTAAGACCCAGTATGAGCTGGGG - Exonic
1126782504 15:52150653-52150675 GAAAGTGGCAGCATTCTCTGTGG - Intronic
1128183000 15:65621358-65621380 GGATGTCCCAGCCTGCTCTGGGG + Intronic
1128347451 15:66863492-66863514 AAAAATCCCAGCATAAGCTGAGG - Intergenic
1128450905 15:67805388-67805410 GACAGCCCCTGCAGGCGCTGAGG + Intronic
1128462895 15:67884680-67884702 CCAAGTCCCAGGACGCGCTGGGG + Intergenic
1130232752 15:82109262-82109284 CAAAGTCCCAGGATGTGGTGGGG + Intergenic
1131048551 15:89331804-89331826 GAAGGTCCCAGCATGAGCCCAGG + Intronic
1138105279 16:54284565-54284587 GGAAGTCCCAGCAGGTGCGGAGG + Exonic
1139531455 16:67544606-67544628 ACAAGTCCCAGCATGCACTGGGG - Intronic
1141309777 16:82902399-82902421 AAAAGTCCCAGCATTAGTTGAGG + Intronic
1143297241 17:5880521-5880543 GACAGGCCCAGTATGTGCTGGGG - Intronic
1144455302 17:15413573-15413595 GGAAATCCAAGCATGCCCTGGGG - Intergenic
1148076077 17:44935881-44935903 CAATGTCCCATCATGCTCTGTGG - Intronic
1148127433 17:45244077-45244099 GCAACTCCCAGCCTGGGCTGCGG + Intronic
1150846457 17:68663709-68663731 TAAAGTGCCAGCCTGCCCTGTGG + Intergenic
1151964404 17:77423858-77423880 GAAAGTCCAGGCATGTGCTCTGG + Intronic
1152361567 17:79835437-79835459 GAAACTCCCGGCATGCGGTGGGG - Intronic
1157099783 18:44719083-44719105 GAAAGTCCCAGCATAGGAAGAGG + Intronic
1162743959 19:12788941-12788963 GAAGGTCCCAGCAGAAGCTGGGG - Intronic
1165046279 19:33107615-33107637 GAAAGTCCCACCATGAGAGGTGG + Intronic
1166641831 19:44500291-44500313 GACAGGCCCAGCCTGGGCTGCGG - Exonic
1167315115 19:48758167-48758189 GAAGGTCCCACCATGCTCAGAGG - Exonic
1168085395 19:54042053-54042075 GAAGGTCACAGAATGGGCTGGGG + Intronic
1168176934 19:54633220-54633242 GTAGGTCCCCGCATGGGCTGAGG - Exonic
1168182648 19:54672561-54672583 GTAGGTCCCCGCATGGGCTGAGG - Intronic
1168189279 19:54726239-54726261 GTAGGTCCCTGCATGTGCTGGGG - Exonic
1168197516 19:54786649-54786671 GTAGGTCCCTGCATGTGCTGGGG - Intronic
1168206175 19:54852184-54852206 GTAGGTCCCTGCATGTGCTGGGG - Exonic
926893609 2:17660201-17660223 GAAAGTCCCGCCTTGAGCTGTGG - Intergenic
928186661 2:29116009-29116031 GAGAGTCCCCGCACGCGCAGTGG + Intronic
929960063 2:46489655-46489677 GAAAGTTCCAGAATGCCCTCAGG + Intergenic
936778216 2:115999593-115999615 GAAAGTGTCAGCATTTGCTGAGG + Intergenic
942232756 2:173875209-173875231 GAAACTCACAGCATCTGCTGTGG + Intergenic
948764714 2:240213510-240213532 GACAGTCCCTGCATGTGTTGGGG - Intergenic
1173060892 20:39659999-39660021 GAAAGTCAGAGAATGAGCTGGGG + Intergenic
1174076235 20:47939293-47939315 GAAAGACCCAGAATGCCTTGAGG - Intergenic
1176904165 21:14479591-14479613 GAAAGTCCCCTCATTCCCTGAGG - Intergenic
1179018809 21:37618669-37618691 GCAAATCCCAACATGCACTGTGG - Exonic
1179817980 21:43920169-43920191 GAGTGTCCCAGCATGCAGTGGGG - Intronic
1180226796 21:46398305-46398327 GACAGTCCCAGCGAGCGCAGGGG - Intronic
1183981643 22:41544096-41544118 GAACATCCCGGCCTGCGCTGGGG + Exonic
1183985147 22:41565676-41565698 CAGAGTCCCAGCATGGGCTGTGG + Intronic
1184503939 22:44889933-44889955 GATATTCCCATCATGCCCTGGGG - Intronic
1184503952 22:44889984-44890006 GATATTCCCATCATGCCCTGGGG - Intronic
1184503967 22:44890034-44890056 GATATTCCCATCATGCCCTGGGG - Intronic
1184503982 22:44890084-44890106 GATATTCCCATCATGCCCTGGGG - Intronic
960064855 3:113360702-113360724 GGAAGTTCCAGCGTGCACTGTGG + Intronic
961429404 3:126870580-126870602 GGAAGCCCCAGGATGTGCTGTGG - Intronic
962342177 3:134594968-134594990 AAAGGTCCCAGGATGTGCTGGGG - Intergenic
962746207 3:138398930-138398952 GTAGGTCCCAGCTTGAGCTGCGG + Intronic
963870427 3:150409240-150409262 CAAAGTCCGAGTCTGCGCTGGGG - Exonic
970284404 4:14493809-14493831 GATAGTTCTAGCATGCTCTGGGG + Intergenic
971802001 4:31304865-31304887 GAAAGTGCCATAATGAGCTGGGG - Intergenic
984839029 4:184051130-184051152 GAAAGTCACAGCTTGCAGTGGGG + Intergenic
987938989 5:24508037-24508059 GAAGTTTCCTGCATGCGCTGTGG + Intronic
991621274 5:68547739-68547761 GAAACTCCCATCATGAGCTTAGG - Intergenic
1000410953 5:160934698-160934720 GAAATGCCCAGCATGTGCTCAGG - Intergenic
1004110956 6:12718299-12718321 GAAAGTCCCAGGATGAGCTGAGG + Intronic
1004249264 6:14009662-14009684 GAAAGGCCCAGCAGGGGCTTTGG - Intergenic
1015523028 6:134150514-134150536 GAATCTCCCAGACTGCGCTGTGG + Intergenic
1018387897 6:163321692-163321714 GAAATGCCCAGCAGGCGCTGGGG - Intergenic
1026876471 7:73881865-73881887 GCATCTCCCAGCATGCCCTGGGG - Intergenic
1040290651 8:46122384-46122406 GAAGCTCCCAGCATTCCCTGCGG + Intergenic
1040292569 8:46132947-46132969 GAGGGTCCCAGCATTCCCTGCGG + Intergenic
1040294256 8:46141142-46141164 GAGAGTCACAGCATTCCCTGCGG + Intergenic
1040298726 8:46176878-46176900 GAGACTCCCAGCATTCCCTGCGG - Intergenic
1040306821 8:46216317-46216339 GAGGCTCCCAGCATTCGCTGTGG - Intergenic
1040307298 8:46218774-46218796 GAAGCTCCCAGCATTCCCTGTGG + Intergenic
1040308911 8:46226563-46226585 GATACTCCCAGCATGCTTTGCGG - Intergenic
1040313419 8:46248576-46248598 GAGACTCCCAGCATTCCCTGTGG - Intergenic
1040315034 8:46256490-46256512 GAGACTCCCAGCATTCCCTGCGG - Intergenic
1040316529 8:46263806-46263828 GAAACTCCCAGCTTTCCCTGTGG - Intergenic
1040324983 8:46337125-46337147 GAAGCTCCCAGCATTCCCTGTGG - Intergenic
1040330372 8:46382813-46382835 GAGGGTCCCAGCATTCCCTGCGG - Intergenic
1040330894 8:46385272-46385294 GAAGCTCCCAGCATTCCCTGCGG - Intergenic
1040331195 8:46386631-46386653 GAAGCTCCCAGCATTCCCTGCGG - Intergenic
1040331767 8:46389228-46389250 GAAAATCCCAGCATTACCTGTGG - Intergenic
1040333348 8:46403585-46403607 GAGACTCCCAGCATTCCCTGCGG - Intergenic
1040335075 8:46411976-46411998 GAAGCTCCCAGCATTCCCTGTGG - Intergenic
1040335813 8:46415404-46415426 GAGGTTCCCAGCATTCGCTGTGG - Intergenic
1040336081 8:46416693-46416715 GAGATTCCCAGCATTCCCTGCGG - Intergenic
1040336168 8:46417123-46417145 GAATCTCCCAGCATTCACTGTGG - Intergenic
1040338808 8:46429626-46429648 GATACTCCCAGCATTCCCTGCGG - Intergenic
1040339970 8:46435510-46435532 GAGGGTCCCAGCATTCCCTGTGG + Intergenic
1040341087 8:46441470-46441492 GAGACTCCCAGCATTCCCTGTGG + Intergenic
1040681478 8:49815997-49816019 GAAAATCCCATCATGAGTTGTGG - Intergenic
1041689074 8:60671770-60671792 GACAGGCCCAGCATGTGATGGGG - Intergenic
1042862149 8:73325744-73325766 GAGAGTGCCAGTATGAGCTGGGG - Intergenic
1053225976 9:36357819-36357841 GCAGGTCCCAGGATGCTCTGTGG - Exonic
1061388985 9:130306855-130306877 GTAATTCCCAGCATCCTCTGGGG - Intronic
1202056882 Y:20843561-20843583 GGCAGTCCCAGCAGGCGCTCAGG - Intergenic