ID: 1080007066

View in Genome Browser
Species Human (GRCh38)
Location 11:27420762-27420784
Sequence GTGTCTTGGGGGAAGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 836
Summary {0: 1, 1: 0, 2: 5, 3: 45, 4: 785}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080007058_1080007066 -4 Left 1080007058 11:27420743-27420765 CCTCTGAACTAGATAATGTGTGT 0: 1
1: 0
2: 1
3: 12
4: 171
Right 1080007066 11:27420762-27420784 GTGTCTTGGGGGAAGGTGGAGGG 0: 1
1: 0
2: 5
3: 45
4: 785

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080007066 Original CRISPR GTGTCTTGGGGGAAGGTGGA GGG Intronic
900690442 1:3977498-3977520 GTGACAAGGGAGAAGGTGGAAGG + Intergenic
901197799 1:7449948-7449970 GTGGCTTGGGGGTAGGAGGGAGG + Intronic
901522071 1:9792759-9792781 GGGTCTTGGACCAAGGTGGATGG + Intronic
902108488 1:14058149-14058171 GGATAGTGGGGGAAGGTGGAGGG - Intergenic
902404122 1:16173786-16173808 GTGACTGGGGGGCAGGTGGGGGG + Intergenic
902682317 1:18052077-18052099 GTGTGTTAGGGGAAGGAGTAGGG - Intergenic
903056441 1:20639439-20639461 TTGTCGTGGGGGATGGAGGAAGG + Intronic
903387615 1:22938221-22938243 GTGGGGTGGGGGAAGGGGGAGGG - Intergenic
903448023 1:23434767-23434789 ATGTCTGGGAGGAAGGTGAAGGG + Intronic
903680716 1:25094974-25094996 GTGTGTTGAGGGCAGGTGGGGGG - Intergenic
903709981 1:25316272-25316294 TTCTCTTGGGGCAAGGTGGGTGG - Intronic
903717133 1:25376134-25376156 TTCTCTTGGGGCAAGGTGGGTGG + Intronic
903920868 1:26799759-26799781 GTGTCTTGGCAGAAGGCAGAGGG - Intergenic
903974395 1:27139647-27139669 GTGTTTGGGGGTGAGGTGGAAGG + Intronic
904456959 1:30653700-30653722 GTGACTTGGGGTGAGGTAGAGGG - Intergenic
904914768 1:33961786-33961808 CAGTCATGGGGGAAGGTGAAGGG - Intronic
905317660 1:37093833-37093855 TTGGCTTCTGGGAAGGTGGAGGG + Intergenic
906146741 1:43565048-43565070 CTGTTGTGGGGGAAGGTGGTGGG - Intronic
906333920 1:44911848-44911870 GTGGGTTGGGGGAGGGGGGAGGG - Intronic
906410439 1:45574450-45574472 GTGTCTTGGAGGGAGTTGCACGG + Intergenic
906438851 1:45822459-45822481 GTGTCTTGTGGGAAGGAATAGGG + Intronic
906466648 1:46087116-46087138 GTGTGTGGGGGAATGGTGGAGGG + Intronic
907032201 1:51183550-51183572 GTGTATTTGGGGAAGGGGAAGGG + Intergenic
907449308 1:54532957-54532979 GTCTCTGGGGGGAGGGGGGAGGG + Intergenic
907847297 1:58220485-58220507 GGGGCTGGGGGGAAGGTGGAAGG + Intronic
907981689 1:59487806-59487828 GAGCCTTGGGGCAAGGGGGAGGG - Intronic
908250301 1:62260539-62260561 GTGTCTTGGCTGAAGGAGGTGGG - Intronic
908395872 1:63725274-63725296 GTCACCTGGGGGATGGTGGAGGG - Intergenic
909663608 1:78110036-78110058 GTGGGGTGGGGGAAGGGGGAGGG + Intronic
909892579 1:81026060-81026082 GTCTTTTGTGGGAACGTGGATGG - Intergenic
910130061 1:83893839-83893861 GTGTCCTAGGGGAAGGGGCAGGG + Intronic
910266914 1:85347615-85347637 GTGGGATGGGGGAGGGTGGAGGG + Intronic
910868528 1:91810055-91810077 GTTTTTTGGGGGTAAGTGGACGG + Intronic
910892057 1:92028836-92028858 CTGTCTTGGGGTGAGGGGGAGGG - Intergenic
911218250 1:95218884-95218906 GAGCTTTGGGGGAGGGTGGAGGG + Intronic
911379953 1:97101131-97101153 GATGCTTGGTGGAAGGTGGAAGG - Intronic
911812658 1:102303190-102303212 TTGTCTTGAGGGAGGGTGGGGGG + Intergenic
912065193 1:105730017-105730039 GTGGGGTGGGGGAAGGGGGAGGG + Intergenic
912212739 1:107572389-107572411 GTGTGTGCGGGGGAGGTGGATGG + Exonic
912283927 1:108348058-108348080 GGGGGTTGGGGGAAAGTGGAAGG - Intergenic
912568365 1:110605156-110605178 CTGCATTGGGGGAAGGTGGCTGG + Intronic
912663872 1:111561501-111561523 ATGTATTGGGGGAAGGAGGGAGG + Intronic
912945521 1:114081041-114081063 GTGTGCTGGGAGAGGGTGGAGGG + Intergenic
913397562 1:118388894-118388916 GTGCCTTGGGGGAAGCTGTGAGG - Intergenic
914414173 1:147463061-147463083 GTCTTTTGGGGGAACATGGATGG - Intergenic
914598036 1:149174003-149174025 GTGGGTTGGGGGGAGGTGGGAGG - Intergenic
915782446 1:158567643-158567665 GTGGGTTGGGGGAGGGGGGAGGG + Intergenic
915964833 1:160297502-160297524 GGTTCTTGGGGGAAGGAGGAAGG - Intronic
916051885 1:161042174-161042196 GTGTCTGAGGGGCAGCTGGATGG - Exonic
916243825 1:162666571-162666593 GTGTGTGGGGGAAAGGGGGAGGG + Intronic
917218697 1:172704556-172704578 TGGTGTTGGGGGAAGGGGGAGGG + Intergenic
917251645 1:173069248-173069270 GTGGTGTGGGGGACGGTGGAGGG - Intergenic
917316551 1:173731714-173731736 TTGTGTTGGGGGAGGGGGGAGGG + Intronic
917442803 1:175081809-175081831 GTAATTTGGGGGAAGGTGTAAGG + Intronic
917485480 1:175451362-175451384 GTGGGGTGGGGGAAGGGGGAAGG - Intronic
917871211 1:179243663-179243685 GTCTCATGGCAGAAGGTGGAAGG - Intergenic
918205046 1:182300708-182300730 GTGTGTTGGTGGAGGGTGGGTGG + Intergenic
919270182 1:195331533-195331555 TTCCCTTGGGAGAAGGTGGAAGG - Intergenic
919281411 1:195494798-195494820 GTGGAGTGGGGGAAGGGGGAGGG - Intergenic
919926743 1:202195348-202195370 GTGTCCTGGTGGGAGGTAGAGGG + Intronic
920348295 1:205321083-205321105 GTGTCCTGGGATAAGATGGATGG - Intronic
920529428 1:206690969-206690991 GTGTCCTGGAGGGAGGTGGATGG + Intronic
920552577 1:206875834-206875856 GTTTTTTGGGGGAGGGGGGAGGG - Intergenic
922242999 1:223768998-223769020 TTGCCTTGGGGAAAGGTGGGTGG - Intronic
922383298 1:225055677-225055699 GTGTGGTGGGGGAGGGGGGAGGG - Intronic
922705072 1:227786372-227786394 ATGTCTTTGAGGGAGGTGGAAGG + Intergenic
922899756 1:229127446-229127468 GTGGCTAGTGGGAAGGTGCAGGG + Intergenic
924085497 1:240447255-240447277 GTGTGTTGGGGGATGTTGGGAGG + Intronic
924226481 1:241926400-241926422 GTGACTTGTGGGGATGTGGAGGG - Intergenic
924903596 1:248428368-248428390 CAATCATGGGGGAAGGTGGAGGG - Intergenic
924924273 1:248663610-248663632 CAATCATGGGGGAAGGTGGAGGG + Intergenic
1062877569 10:954945-954967 CTGTCCTGGGGAAGGGTGGATGG - Intergenic
1062877606 10:955075-955097 CTGTCCTGGGGAAGGGTGGATGG - Intergenic
1063558580 10:7104535-7104557 GTCTTTTGGGTGAATGTGGATGG - Intergenic
1064000831 10:11662607-11662629 GTGTGTTGGGGGCAGGAGGGAGG - Intergenic
1064019352 10:11796778-11796800 GTCTTTTTGGGGAAGGGGGAAGG + Intergenic
1064035229 10:11908933-11908955 GACGCTTGGGGGATGGTGGATGG - Intergenic
1064535224 10:16351235-16351257 CTGTCTCGGTGGCAGGTGGAGGG - Intergenic
1064808331 10:19163341-19163363 GTCTTTTGTGGGAACGTGGATGG + Intronic
1064864204 10:19860948-19860970 GTGTCTTGGGGCTAGGAAGATGG - Intronic
1065667195 10:28075046-28075068 CAGTCATGGGGGAAGGTGAAGGG + Intronic
1066594173 10:37030601-37030623 GTGGGGTGGGGGAAGGGGGAAGG + Intergenic
1066725728 10:38390658-38390680 GTGGCGTGGGGGATGGGGGAGGG + Intergenic
1067035616 10:42914318-42914340 GTGTGTAGAGGGAAGGTGCAAGG - Intergenic
1067111913 10:43407397-43407419 GTGTCCCGGCGGAGGGTGGAAGG - Intronic
1067300967 10:45009315-45009337 GTGGGGTGGGGGAAGGGGGAGGG - Intergenic
1067832145 10:49616423-49616445 GTCTGTTGGCGGGAGGTGGAGGG + Intronic
1068206728 10:53864413-53864435 GAGACATGGGGGAAGGGGGAAGG - Intronic
1068607339 10:59020567-59020589 ATGTTTTGGTGGAAGGTGGGGGG - Intergenic
1068950539 10:62772533-62772555 GTGCTTCGGGGGAAAGTGGAGGG + Intergenic
1069184075 10:65400471-65400493 GAGTGGTGGGGGAAGGGGGAAGG - Intergenic
1069320903 10:67170457-67170479 GTCTTTTGTGGGAACGTGGATGG + Intronic
1069421097 10:68247281-68247303 GTGTGTTGCGGGGAGGGGGAAGG + Intergenic
1069524658 10:69158582-69158604 ATTTCTTGGGGGGAGGGGGAAGG + Intronic
1069556914 10:69404579-69404601 TTGTCATGGTGGAAAGTGGAAGG + Exonic
1069591180 10:69643012-69643034 GAACCTTGGGGGAAGATGGAGGG - Intergenic
1070030671 10:72674173-72674195 GTGGGGTGGGGGAAGGGGGAGGG - Intergenic
1070276584 10:75013060-75013082 ATGTCTTTGGGGAAGGAGGCTGG - Intronic
1070688127 10:78504917-78504939 GTGCCTTGGGGAAAGGAGGCAGG + Intergenic
1070805692 10:79269440-79269462 GTGTGTTGGGGGGAGGTGTTGGG - Intronic
1070840872 10:79487079-79487101 GTGTTTGGGGGGACTGTGGAGGG + Intergenic
1071144889 10:82556942-82556964 GTGTTTTGTGGGAACATGGATGG - Intronic
1071343535 10:84669780-84669802 GTGTTTTGTGGGAACATGGATGG + Intergenic
1072397370 10:95058785-95058807 GTGTGGTGGGGGGAGGGGGAAGG - Intronic
1072405986 10:95153367-95153389 GTGGGTTGGGGGAAGGAGGGAGG + Intergenic
1073213978 10:101826554-101826576 TTGTGGTGGGGGAATGTGGATGG - Intronic
1073269182 10:102247288-102247310 GTGTGTTGGGAGAAGGGGGATGG + Intronic
1073588857 10:104736922-104736944 GTGGGGTGGGGGAAGGGGGAGGG - Intronic
1073614260 10:104976908-104976930 GTGGGGTGGGGGAAGGTGGGAGG + Intronic
1074418245 10:113286200-113286222 GTGTCATGGGGGAAGGAGGAAGG - Intergenic
1074829010 10:117235670-117235692 GGGTCTTGGGAGGAGGAGGAGGG - Intergenic
1075323514 10:121511437-121511459 GGGTGGTGGGGGAAGGTGTAGGG - Intronic
1075449136 10:122536069-122536091 GCGTATTGGGGGAAGGAGGCTGG + Intergenic
1075874230 10:125793333-125793355 GTGACTTGGGGGTGGGTGGGTGG + Intronic
1076434030 10:130427346-130427368 GTGCCTTTGGAGCAGGTGGAGGG + Intergenic
1076585759 10:131546434-131546456 GTGCCTGTGGAGAAGGTGGAGGG - Intergenic
1077291936 11:1800849-1800871 GTGGGTTGGGGGGAGGGGGAGGG - Intergenic
1077423298 11:2462937-2462959 GGGTCTTGGGGGAAGGCTGTGGG + Intronic
1078178551 11:8989617-8989639 GTATCTTTGGGAAAAGTGGAGGG + Intronic
1078490177 11:11761016-11761038 CTGTCTTGGAAGAAGGAGGAAGG - Intergenic
1078718923 11:13865712-13865734 GTGGGTTGGGGGAGGGGGGAGGG - Intergenic
1079174491 11:18126633-18126655 GTGGGGTGGGGGAAGGGGGAGGG - Intronic
1079598587 11:22284539-22284561 GTGTTTTGGGGGATGGGGGTGGG + Intergenic
1080007066 11:27420762-27420784 GTGTCTTGGGGGAAGGTGGAGGG + Intronic
1080077496 11:28168608-28168630 GTGGCATGGGGGGAGGGGGAGGG - Intronic
1080824281 11:35834865-35834887 GTGAGCAGGGGGAAGGTGGAGGG - Intergenic
1080866012 11:36195745-36195767 GTGTCTTGGGTGACTGAGGAGGG - Intronic
1081000188 11:37659739-37659761 GTGGGGTGGGGGAGGGTGGAGGG + Intergenic
1081182087 11:39996329-39996351 ATGCCATGGTGGAAGGTGGAAGG - Intergenic
1081596504 11:44463071-44463093 GAGTCATGGTGGAAGGTGAAGGG + Intergenic
1081781386 11:45715524-45715546 GTTTGCTGGGGGAAGGTGGGAGG - Intergenic
1081789424 11:45772224-45772246 GACTCTAGGGTGAAGGTGGAGGG + Exonic
1083063947 11:59903990-59904012 CTGTTTTGGGGGAGGGGGGAGGG + Intergenic
1083171302 11:60925190-60925212 GAGCCCTGGGGGAAGGGGGAGGG - Intronic
1083325446 11:61870771-61870793 GTGTGTTGGGAGTAGCTGGAGGG - Intergenic
1083408539 11:62475353-62475375 GTCTTTTGTGGGAACGTGGATGG + Intronic
1083527973 11:63389323-63389345 GGGGGTTGGGGGAAGGGGGAGGG - Intronic
1083711292 11:64550644-64550666 GTATCTTGTGGGAACATGGATGG - Intergenic
1083827697 11:65212505-65212527 GTGGTTTGGGGGAAGGAAGAGGG + Intergenic
1083857391 11:65399942-65399964 GGGCCTGGGGGCAAGGTGGATGG + Intronic
1084171837 11:67404654-67404676 GTAGCTTGGGGAAAGGGGGAAGG - Intronic
1084207801 11:67606111-67606133 GGGTCTTGGGGGACGGGGGTGGG + Intronic
1084560295 11:69901495-69901517 GAGAGTTGGGGGAAGGCGGAAGG - Intergenic
1085511125 11:77088667-77088689 GTGACTAGGGTGAAGCTGGATGG + Intronic
1085678916 11:78552296-78552318 ATGTCTTGGGGGAACGTGGATGG - Intronic
1085713905 11:78854706-78854728 GAATCTTGGGGGGTGGTGGAGGG + Intronic
1085946635 11:81280429-81280451 GTCTGTTGGGGGGCGGTGGAGGG - Intergenic
1087775501 11:102253133-102253155 ATCTCATGGTGGAAGGTGGAAGG + Intergenic
1087982356 11:104631649-104631671 GGGTCATGGGGTAAGGTGGTGGG - Intergenic
1088413061 11:109556869-109556891 CGGGCTTGGGGGAAGGAGGAGGG + Intergenic
1088710634 11:112505442-112505464 GTGGGGTGGGGGAAGGGGGAGGG - Intergenic
1088718915 11:112574791-112574813 GTGGGGTGGGGGAAGGGGGAGGG - Intergenic
1088908199 11:114170560-114170582 CTGGTTTGGGGGAAGGAGGAGGG - Intronic
1089147327 11:116338857-116338879 GTGGGTTGAGGGAAGGGGGAGGG + Intergenic
1089164912 11:116468365-116468387 ATTTCCTGGGGGAAGCTGGATGG + Intergenic
1090071814 11:123550560-123550582 GTGGGGTGGAGGAAGGTGGAGGG + Intronic
1091201989 11:133788030-133788052 GTTTCGTGGGAGCAGGTGGACGG - Intergenic
1091399028 12:171679-171701 GAGACTTGGGGGCAGGTGGGAGG + Intronic
1091666262 12:2420515-2420537 GTGTGTTGGGCCAAGGTGGAAGG + Intronic
1092588593 12:9926573-9926595 GAGTTTTGGGGGAATGAGGAAGG + Intronic
1092783884 12:12010727-12010749 GTGTGTTTAGGGAAGATGGATGG - Intergenic
1093090585 12:14915858-14915880 GTCTTTTGTGGGAACGTGGATGG + Intronic
1093437306 12:19150317-19150339 CTGTTTTGGGGGATGGAGGAAGG + Intronic
1093493234 12:19727251-19727273 GTCTTTTGTGGGAAGCTGGATGG + Intergenic
1093643435 12:21554669-21554691 GTGTGTTAGGGAAAGGTGCAAGG + Intronic
1095476473 12:42590929-42590951 GTGTGTGGGGGGAGTGTGGAGGG + Intergenic
1095968911 12:47888080-47888102 GTATCATGGCGGAAGGTGAAAGG + Intronic
1096580240 12:52580419-52580441 GTGGCTGGAGGGGAGGTGGAGGG - Intergenic
1096603783 12:52749901-52749923 ATGTCCTGGGAGAAGGAGGAAGG + Intergenic
1096689273 12:53309510-53309532 ACATCTTGGGGGAAGGAGGAGGG - Intronic
1096793362 12:54058985-54059007 GTGTGTTGGGGGGAGTTGTAGGG + Intergenic
1097041387 12:56158153-56158175 GGGTCGTGGGGGGAGGTGGGGGG - Exonic
1097167522 12:57093663-57093685 GTGTCCTGGGGCCAGGTGGGAGG + Intronic
1097242129 12:57582718-57582740 GAGCCTTTGGGGAAGGGGGAGGG + Intronic
1097465209 12:59914497-59914519 GTGTGATGGAGGAAGGTAGAAGG - Intergenic
1097468242 12:59954134-59954156 GTGCCATGGGGGAAGGGGGGAGG + Intergenic
1097580350 12:61447912-61447934 GTGGGTTGGGGGACGGGGGAGGG + Intergenic
1097919901 12:65060533-65060555 GTGTCTGGAGGGAAAGGGGAAGG + Intronic
1098035409 12:66296877-66296899 TTGTATTGGGGGAATGGGGAGGG - Intergenic
1098069323 12:66655150-66655172 GCCTCTTGGGGGAACGTGGAGGG - Intronic
1098187507 12:67913121-67913143 GTGTATTGGGGGGAGGTGCTAGG - Intergenic
1098850939 12:75594926-75594948 GTCTTTTGGGGGAACATGGATGG + Intergenic
1098895994 12:76061431-76061453 GTCTTTTGTGGGAACGTGGACGG - Intronic
1099096490 12:78380292-78380314 TTGTGTTTGGGGAAGGAGGAAGG - Intergenic
1099196854 12:79626731-79626753 GTGGGGTGGGGGAAGGGGGAGGG - Intronic
1099239563 12:80123175-80123197 GTGGGGTGGGGGAAGGGGGAGGG - Intergenic
1099842495 12:87983532-87983554 GTGGGGTGGGGGAAGGGGGAGGG - Intronic
1099900750 12:88708997-88709019 GTGGGGTGGGGGAAGGTGGGAGG - Intergenic
1099935433 12:89119356-89119378 GTTTGTTGGGGGACGGGGGAAGG - Intergenic
1100661149 12:96700272-96700294 GTGTCATGGGGGAGGGAGCATGG + Intronic
1101315524 12:103625501-103625523 GTGGGTGGGGGGAAGGAGGAGGG - Intronic
1101349344 12:103914001-103914023 GTGTCCTGGGGGTAGGAGGATGG - Intergenic
1102247583 12:111365059-111365081 ACTCCTTGGGGGAAGGTGGATGG - Intronic
1102763287 12:115408290-115408312 GTTTCTGAGGGGAAGGTGGAAGG + Intergenic
1102867922 12:116388948-116388970 GTGTGTGGCGGGAGGGTGGAGGG - Intergenic
1102983679 12:117262263-117262285 GTCTCTGGGGGGAAAGGGGAGGG - Intronic
1103141609 12:118553546-118553568 GTCTTTTGTGGGAACGTGGATGG + Intergenic
1103225242 12:119281871-119281893 GTGTCGAGGGGGTAGGTGGAGGG - Intergenic
1104012738 12:124943441-124943463 GCTGCTTCGGGGAAGGTGGAAGG + Intergenic
1104545995 12:129713464-129713486 GTGTGTTTTGGGAAGGAGGAGGG + Intronic
1104736834 12:131140157-131140179 GTGTCCAGGTGGAAAGTGGAGGG + Exonic
1104779818 12:131412928-131412950 GTGTGTTGGGGGCAGGATGAGGG + Intergenic
1105072565 12:133243957-133243979 GTCTTTTGTGGGAACGTGGATGG - Intergenic
1105508065 13:21028071-21028093 GTGGGGTGGGGGAAGGGGGAGGG - Intronic
1105596298 13:21842546-21842568 GTGGTTAGGGGGAAGGGGGATGG + Intergenic
1106101806 13:26699906-26699928 GTATCTTGGGGCAAAGTGGTAGG + Intergenic
1106840982 13:33684848-33684870 GTTTCTTGGGGGCAGGAGGGCGG - Intergenic
1107300867 13:38964344-38964366 GGGTGGTGGGGGAAGTTGGAAGG - Intergenic
1107840208 13:44449979-44450001 GTGACTTGGGGGCAGTTGCAGGG + Intronic
1108413835 13:50177485-50177507 GTGTGTTGGGGGTAGGAGGTGGG + Intronic
1108631974 13:52293241-52293263 GTCTTTTGTGGGAACGTGGATGG + Intergenic
1108654724 13:52519353-52519375 GTCTTTTGTGGGAACGTGGATGG - Intergenic
1109058908 13:57587167-57587189 GTGGGGTGGGGGAAGGGGGAGGG + Intergenic
1109365802 13:61354992-61355014 GTGGGGTGGGGGAAGGGGGAAGG - Intergenic
1109913803 13:68953140-68953162 GTGTCCTGGGGGAAGGATGGTGG + Intergenic
1110288817 13:73780389-73780411 GGGACTCGGGGGAAGGTTGATGG - Intronic
1110479886 13:75961647-75961669 GTGGGGTGGGGGAAGGGGGAGGG + Intergenic
1110810185 13:79803978-79804000 GTGACTGGGGGGAAGGAGAAGGG + Intergenic
1110885529 13:80629202-80629224 GTGTCTTGGGAGAAAGCAGAAGG + Intergenic
1111333073 13:86786371-86786393 ATCTCATGGCGGAAGGTGGAAGG + Intergenic
1111640069 13:90957385-90957407 GTGGGGTGGGGGAAGGGGGAGGG + Intergenic
1112015336 13:95326826-95326848 GTATCATGGGGGAAGGTGCCTGG + Intergenic
1112475878 13:99730491-99730513 CTGTCTTGAGGAAAGCTGGAAGG - Intronic
1112488002 13:99836889-99836911 GTGGGGTGGGGGAAGGGGGAGGG + Intronic
1113062062 13:106332642-106332664 GTGTGTTGGGGGCAGGGGGGCGG - Intergenic
1113615248 13:111675931-111675953 CAGTCATGGTGGAAGGTGGAGGG + Intergenic
1113620715 13:111760844-111760866 CAGTCATGGTGGAAGGTGGAGGG + Intergenic
1113769775 13:112900623-112900645 GTGTGTTGGGGGAAGAGGGGCGG + Intronic
1113822765 13:113226968-113226990 GTGCCCTGGGGGTAGGTGGCGGG - Intronic
1114320522 14:21543612-21543634 GTGTTTTAGGGGAAGAGGGAGGG + Intergenic
1114494898 14:23125938-23125960 CTGTCTTGGGGCAGGGTGAAAGG - Exonic
1115412748 14:33093968-33093990 GTGGGGTGGGGGAAGGGGGAGGG + Intronic
1115420917 14:33194746-33194768 GTCACTTGGTGGAATGTGGATGG + Intronic
1115515507 14:34181053-34181075 GAGTTTTGGGGGTAGGTGGGTGG - Intronic
1116062530 14:39941937-39941959 GTGTGGTGGGGGGAGGGGGAGGG - Intergenic
1116538548 14:46066539-46066561 GTGGGTTGGGGGAGGGGGGAGGG + Intergenic
1116579061 14:46615496-46615518 GTGGGGTGGGGGAAGGTGGGAGG - Intergenic
1117438729 14:55741369-55741391 GAGGCCTGGGGGAAGGAGGAGGG + Intergenic
1118181045 14:63493500-63493522 GTGTGGTGGGGGGAGGGGGAGGG + Intronic
1119116001 14:72022076-72022098 GTCTCTTGTGGGAACATGGATGG - Intronic
1119242691 14:73074566-73074588 CTGTCTTGTGGGGAGGTGGGGGG + Intronic
1119333000 14:73809479-73809501 GTGTCTTGGGTGGTGGTGGGAGG - Intergenic
1119526316 14:75325197-75325219 ATGTCATGGTGGAAGGTGGCTGG + Intergenic
1119730841 14:76950286-76950308 GTGTGTAGGGGGCAGGTGGTGGG + Intergenic
1119974586 14:79011367-79011389 GTGGGTTGGGGGGAGGTGGGGGG - Intronic
1120284435 14:82480319-82480341 GTCCGTTGGTGGAAGGTGGAGGG + Intergenic
1120286137 14:82504511-82504533 GTGTTTTGGTGGGAGGTGAAAGG + Intergenic
1121582945 14:95044586-95044608 GAGTCTCGGGGGAAGGTGTATGG - Intergenic
1121774808 14:96583662-96583684 GTGTGTTGGGGGAGGGCGGGTGG + Intergenic
1122114225 14:99519893-99519915 GTGGCTGGGAGGAAGGGGGACGG + Intronic
1122267825 14:100554882-100554904 GTGCCTGGCGGGAAGGTGGGGGG - Intronic
1122291057 14:100680705-100680727 GAGTCTTGTGGGAAAGCGGATGG + Intergenic
1122587447 14:102819131-102819153 GGGTCTTGGGGGAAGGGAGAAGG - Intronic
1122625259 14:103082249-103082271 GTTGCATGGGGGAAGGTAGATGG + Intergenic
1122645522 14:103190798-103190820 GTGTCTGGGAGAAATGTGGAAGG + Intergenic
1202943619 14_KI270726v1_random:6655-6677 GGGGGTTGGGGGAAGGGGGAGGG - Intergenic
1123487170 15:20751745-20751767 GAGTCGTGGGAGAAGGTGGTAGG - Intergenic
1123543660 15:21320800-21320822 GAGTCGTGGGAGAAGGTGGTAGG - Intergenic
1124176638 15:27431588-27431610 TTGTCTTGTTGGAAGGGGGAAGG + Intronic
1124637541 15:31374633-31374655 CTGCCTTGGGGAACGGTGGACGG - Exonic
1125536989 15:40446782-40446804 CTGTCTTTGGGTAAGGAGGATGG + Intronic
1125861665 15:43005406-43005428 CTGTCTTGGAGGGAGGTGGGGGG + Intronic
1125930342 15:43595244-43595266 GAGTCTTGGGGGAAAGTGAGAGG - Intronic
1125943510 15:43695076-43695098 GAGTCTTGGGGGAAAGTGAGAGG - Intronic
1125947715 15:43723474-43723496 GTGTTTTGGGGGAAAAGGGAAGG + Intergenic
1126419493 15:48456409-48456431 GTGTGTTGGGGGAAAGGGGCTGG + Intronic
1127147426 15:56038942-56038964 CAGTGTTGGGGGAAGGTGGGAGG - Intergenic
1127236618 15:57059736-57059758 GGGGCTGGGGGGAGGGTGGAGGG + Intronic
1127304144 15:57685506-57685528 GTGTGTCGGGGGAGGGTGGGGGG + Intronic
1127670228 15:61187941-61187963 GTGTGTTAGGGGAGGGTTGAGGG - Intronic
1128055793 15:64699358-64699380 GTTTTTTGGGGGAAGGGGGCAGG - Intronic
1128745561 15:70111734-70111756 GAGGCTTGGGGGGAGGGGGAGGG + Intergenic
1129161810 15:73751949-73751971 CTGGCTGGGGGGAAGGTGGGGGG - Intronic
1129300664 15:74623730-74623752 GTCACTAGGGGGCAGGTGGAGGG + Intronic
1129521600 15:76189790-76189812 GGGACCTGGGGAAAGGTGGAGGG + Intronic
1130209981 15:81914106-81914128 GAATCTTGGGAGAAAGTGGAAGG - Intergenic
1130417736 15:83709794-83709816 TAGGCATGGGGGAAGGTGGAAGG + Intronic
1130570968 15:85043361-85043383 TTGTCTTTTGGGAGGGTGGAGGG + Intronic
1130689582 15:86070143-86070165 GTGGGGTGGGGGATGGTGGAGGG - Intergenic
1130768496 15:86899225-86899247 GTCTTTTGTGGGAACGTGGATGG + Intronic
1130849257 15:87777824-87777846 GCGCCTCGGGGGAAGGAGGAAGG + Intergenic
1131015282 15:89052851-89052873 ATGTCTTGGAGAAAGGTGAAAGG - Intergenic
1131770778 15:95735125-95735147 GTGACTTTGGGGAAAGTGAATGG + Intergenic
1131890459 15:96966341-96966363 GGGTTTTGGGGGTAGGGGGAGGG + Intergenic
1132243198 15:100276232-100276254 GTGCCTGGTGGGAAGGTGGGAGG + Intronic
1132243221 15:100276290-100276312 GTGCCTGGTGGGAGGGTGGAAGG + Intronic
1202951977 15_KI270727v1_random:47926-47948 GAGTCGTGGGAGAAGGTGGTAGG - Intergenic
1134193050 16:12137270-12137292 GTGTCTTGGCTGTAGGTGGCTGG + Intronic
1134272157 16:12742526-12742548 GTGGTTTGGAGGAAGGTGGCAGG - Intronic
1135220796 16:20612623-20612645 GTGACTTGGAGGATGGTCGAAGG + Intronic
1135222475 16:20624854-20624876 GTGTGGTGGGGGCAGGTGGGTGG - Intronic
1136033155 16:27518170-27518192 GTGTCTTGGGCGGGGGTGGTGGG - Intronic
1136568385 16:31083017-31083039 GGGTCGTGGGGGTGGGTGGAGGG - Exonic
1136913489 16:34162107-34162129 GTGTCGTGGGGCAGGCTGGATGG + Intergenic
1137621356 16:49878516-49878538 GTGGGTTGGGGGAGGGGGGAGGG - Intergenic
1137902118 16:52280038-52280060 TTGTCATGGGGGAAGGAGGGTGG - Intergenic
1138109157 16:54309485-54309507 GTGACATGTGGGAAGGAGGAAGG - Intergenic
1138249097 16:55488796-55488818 CTGTCTTGGGGAAAGGAGGTGGG - Intronic
1139031395 16:62885843-62885865 GAGTCATGGTGGAAGGTGAAGGG - Intergenic
1139126783 16:64088227-64088249 CTGTCATGGGGGCAGGTGGTGGG - Intergenic
1139251611 16:65501900-65501922 GTGTCATGGTTGAAGGTGGTTGG - Intergenic
1139308750 16:66010577-66010599 TTATCTAGGAGGAAGGTGGAGGG - Intergenic
1139624998 16:68180642-68180664 GTGGGGTGGGGGAAAGTGGAAGG - Intronic
1139839655 16:69868179-69868201 GTGTGTTGGGGGGTGGTGGCTGG + Intronic
1139910884 16:70396838-70396860 GAGCCTTGGGGCAAGGTAGAAGG + Intronic
1140393072 16:74605174-74605196 GGGGGTTGGGGGGAGGTGGAGGG - Intronic
1141258027 16:82421676-82421698 GTGTTTAGGAGCAAGGTGGAAGG + Intergenic
1142643054 17:1295712-1295734 GTGGGTTGGGGGAAGGAGAAGGG + Intronic
1143432971 17:6900356-6900378 GTGTGGTGGTGGAAGGTGGGAGG + Intronic
1144066259 17:11627070-11627092 GAGTCTGGGGGAAAGCTGGATGG + Intronic
1144084753 17:11798673-11798695 GTACCCTGGGGGAAGGCGGAAGG - Intronic
1144737915 17:17565161-17565183 AGGTCCTGGGGGAAGGGGGATGG - Intronic
1144771374 17:17761502-17761524 GTGCCCCGGGGGATGGTGGAAGG + Intronic
1146092585 17:29894826-29894848 CTTAATTGGGGGAAGGTGGAAGG - Intronic
1146296267 17:31653107-31653129 TTCTCATGGAGGAAGGTGGAGGG + Intergenic
1146601506 17:34221064-34221086 GTGTCTTGGTGTGAGGGGGATGG - Intergenic
1147164407 17:38585831-38585853 GTGTGATGGGGGAAGGGCGATGG + Intronic
1147210592 17:38870548-38870570 GTGTGTTGGGGGAAGGTTAGGGG + Intronic
1147326528 17:39672357-39672379 GTGTCCTGGAGGAGGGTGGGGGG + Exonic
1147390321 17:40105257-40105279 GTGTGGTGGGGGGAGGGGGATGG + Intergenic
1147441078 17:40447559-40447581 GTGCCTTGTGGGGAGGGGGAGGG + Intronic
1147473764 17:40689789-40689811 GTGGAGTGGGGGAAGGTGGGAGG - Intergenic
1147649254 17:42052855-42052877 GTGACTTGGGGGTAGGGGGATGG - Intronic
1147914831 17:43879981-43880003 GTGTCTAGGGGGATGGGGGTAGG + Exonic
1147924693 17:43939091-43939113 GTGGAGTGGGGGAAGGTGGATGG - Intergenic
1148465954 17:47865473-47865495 GTGGCTTGGAGGCAGGAGGATGG - Intergenic
1148788021 17:50155240-50155262 GTGTGTTGGGGGGCGGGGGAAGG + Intergenic
1149080837 17:52655306-52655328 GTGGGGTGGGGGAAGGTGGGAGG - Intergenic
1149520582 17:57315413-57315435 GGGGCTTGGGGGTCGGTGGAGGG + Intronic
1149814809 17:59713250-59713272 GTGGGTTGGGGGAAGGAGGGAGG + Intronic
1150154759 17:62843621-62843643 GTCTTTTGCGGGAACGTGGATGG + Intergenic
1151162335 17:72176031-72176053 ATGTGTTGGGGGAAGGGGGGAGG - Intergenic
1151759261 17:76091304-76091326 GGGCCTGGGGGGCAGGTGGAGGG - Intronic
1152372191 17:79895884-79895906 CTCACTTGGTGGAAGGTGGAAGG - Intergenic
1153186337 18:2490510-2490532 GTGGCGTGGGGGGAGGGGGAGGG + Intergenic
1153358139 18:4161232-4161254 CTGTCCTGGGGAAAGGTGGCGGG - Intronic
1154308048 18:13244685-13244707 GTGTCTTGGGGGAAGAGGGAAGG - Intronic
1154492101 18:14930340-14930362 GTTTCTGGGAGGAAGGTGGGTGG + Intergenic
1155075578 18:22351195-22351217 GTGTGTTGGGGGAAGGGAGATGG + Intergenic
1155426397 18:25711906-25711928 GTGTCTTGGGGGAATCTTGGGGG - Intergenic
1155756841 18:29509145-29509167 GTGGGGTGGGGGAAGGGGGAAGG - Intergenic
1156061336 18:33080114-33080136 GTCTTTTGTGGGAATGTGGATGG + Intronic
1156495481 18:37522876-37522898 GTTTCATGGGAGAGGGTGGATGG - Intronic
1156550907 18:38015654-38015676 CTGTCTGGGGGTAAGGTGGAGGG - Intergenic
1156897737 18:42265808-42265830 GTGTGGTGGGGGAGGGGGGAGGG - Intergenic
1157095469 18:44682246-44682268 GTGTCGTGGGAGAAAGGGGATGG + Intronic
1157564429 18:48670348-48670370 GTGTAATGGGGCAAGGTGGATGG + Intronic
1157788522 18:50508443-50508465 GTCTTTTGGGGGAACATGGATGG + Intergenic
1158491835 18:57916840-57916862 GTGTCTTGGGGGGAAGTGAATGG + Intergenic
1158614640 18:58975396-58975418 GTGACTTTGGGGAAGTTAGAGGG - Intronic
1158738217 18:60108155-60108177 GAGTCTTGGGGAAAGGCAGAAGG - Intergenic
1158839835 18:61373476-61373498 GTGCCATGAGGGAAGATGGAGGG - Intronic
1159192901 18:65071339-65071361 GGGACTTGGGGAAAGGTGGGAGG - Intergenic
1159632903 18:70769312-70769334 GGCTTTTGGGGGAGGGTGGATGG + Intergenic
1160122189 18:76140573-76140595 GAGTCATGGTGGAAGGTGAAAGG - Intergenic
1160506039 18:79427387-79427409 GTGGGTTGGGGGGAGCTGGATGG + Intronic
1160506073 18:79427494-79427516 GTGGGTCGGGGGAAGCTGGACGG + Intronic
1161155484 19:2730345-2730367 CTGTGATGGGCGAAGGTGGATGG + Intronic
1161363780 19:3867361-3867383 CAGTCTTGGGGGCAGATGGACGG + Intronic
1162108986 19:8390190-8390212 GTGTCCTGGAGAAAGGCGGAAGG - Exonic
1162237375 19:9319803-9319825 GTGTGGTGGGGGGAGGGGGAGGG + Intergenic
1162318528 19:9956628-9956650 GGGTCTGGGGGGAGGGGGGAGGG - Intergenic
1162540807 19:11294890-11294912 ATGGATTGGGGGAAGGCGGATGG - Intergenic
1163171641 19:15535586-15535608 GTGGATAGGTGGAAGGTGGATGG - Intronic
1163342963 19:16721618-16721640 GTGAGTTGTGGGAAGGTGGCTGG + Intronic
1163952442 19:20602416-20602438 TTTTCTTGGGGGGAGGGGGATGG + Intronic
1163972639 19:20813666-20813688 GTGGGTTGGGGGGAGGGGGAAGG + Intronic
1164321065 19:24147669-24147691 GTGGCTTGGGGGAGGGGGAAGGG - Intergenic
1164554639 19:29241808-29241830 GTGACTTGGGGGAAGAAAGAAGG - Intergenic
1165012622 19:32859785-32859807 GTGGCTTGTGGGAAGGGGTAAGG - Intronic
1165310094 19:35024517-35024539 GTGTCGAGGGGGAAAGCGGATGG + Intronic
1165348342 19:35262757-35262779 CTGTCCTGGGGGCAGGTGGATGG - Intronic
1165448327 19:35868797-35868819 GGGTCCTGGGGGATGGGGGAAGG + Intronic
1165710871 19:38009901-38009923 GTGGGTTGGAGGAAGGTGGGTGG + Intronic
1166354280 19:42217729-42217751 GCGAGTTGGGGGAAGGAGGAGGG - Intronic
1166798916 19:45444144-45444166 GTGTATTGGGGTCAGTTGGAGGG - Intronic
1166822658 19:45590142-45590164 GTGACTCGGGGGAAAGTGGAAGG - Exonic
1167360120 19:49025631-49025653 GTGGCCCGGGGGTAGGTGGAGGG - Intronic
1167367291 19:49061530-49061552 GTGGCCCGGGGGCAGGTGGAGGG - Exonic
1167383412 19:49150916-49150938 GTGGCGTGGGGGCAGGGGGACGG + Exonic
1167421103 19:49403855-49403877 GTGTGGAGGGGGAAGGTAGAGGG - Intronic
1167560111 19:50221928-50221950 TTGACTTGGGGGAAGGAGCAGGG - Intronic
1167575760 19:50316782-50316804 GACTCTTGGGGGAAGGAGCATGG + Intronic
1167668823 19:50838413-50838435 CTGTGCTGGGGGAAGCTGGAGGG + Intergenic
925028040 2:625072-625094 GTGGCGCGGAGGAAGGTGGATGG - Intergenic
925184264 2:1836406-1836428 GAATCTTGGGGGCAGGTTGATGG - Intronic
925781821 2:7388519-7388541 GAGTCATGGCGGCAGGTGGAAGG + Intergenic
926209134 2:10856132-10856154 GTGTGTTGGGGGGGGGTGGTGGG + Intergenic
926406799 2:12561850-12561872 GTGTAGAGAGGGAAGGTGGAGGG + Intergenic
927039126 2:19210416-19210438 GTGGGGTGGGGGAAGGGGGAAGG - Intergenic
928225881 2:29447657-29447679 GTGGCTGGGGGAGAGGTGGAGGG + Intronic
928435796 2:31253734-31253756 GTGTCTTGTGGGAAGAAGGCTGG + Intronic
928945076 2:36764875-36764897 ATGTCAAAGGGGAAGGTGGATGG + Intronic
930364206 2:50418365-50418387 GTGTGTTGGGGGAGGCTGCAAGG - Intronic
930401403 2:50894088-50894110 GTGGGTTGGGGGGAGGGGGAAGG + Intronic
930526508 2:52536881-52536903 GTGGGGTGGGGGAAGGTGGGAGG + Intergenic
930835401 2:55788259-55788281 GTGGGGTGGGGGAAGGGGGAGGG - Intergenic
930838488 2:55819985-55820007 GTGGGGTGGGGGAAGGGGGAGGG + Intergenic
931243702 2:60475718-60475740 GTGTAGTGGGGGCAGGGGGAGGG + Intronic
931732462 2:65165390-65165412 GGTAGTTGGGGGAAGGTGGATGG + Intergenic
931757818 2:65389390-65389412 GTGTGTTGGGGGAGGAAGGAGGG + Intronic
932428473 2:71658915-71658937 CTGTCTTGGGGGCATGGGGATGG - Exonic
936159743 2:110075784-110075806 GTGGGGTGGGGGAAGGGGGAGGG + Intergenic
936184922 2:110295569-110295591 GTGGGGTGGGGGAAGGGGGAGGG - Intergenic
937301608 2:120846172-120846194 GTGGCTTTGAAGAAGGTGGAAGG - Intronic
937383229 2:121400839-121400861 GTGATTTGGTGGAAGATGGATGG - Intronic
937806678 2:126152874-126152896 GTGTCTTGTGGGAATATTGATGG - Intergenic
937818997 2:126286992-126287014 GACTCTTGGTGGATGGTGGATGG - Intergenic
938403375 2:131012572-131012594 GTGTGTTGGGGGGTGGGGGAGGG + Intronic
938537905 2:132260024-132260046 GTGGGGTGGGGGAAGGTGGGAGG - Intergenic
939542784 2:143513869-143513891 GGCTCTTGGGGGAGGGAGGATGG - Intronic
940154697 2:150643197-150643219 GTGTGCTGGGGGAGGATGGAGGG - Intergenic
940395644 2:153187398-153187420 CTGACTTGGGGGAAGGGGAAAGG + Intergenic
941726980 2:168871206-168871228 GTGGGTTGGGGGAGGGGGGAGGG + Exonic
941811558 2:169760581-169760603 ATGTCTTGTGGGAACATGGATGG + Intronic
941904201 2:170705441-170705463 GTGGCTTGGGGCAAGGGGTAGGG + Intergenic
942264723 2:174211164-174211186 GTGTGTTGTGGGGAGGAGGAAGG - Intronic
942818523 2:180081778-180081800 GTCTTTTGGGGGAAGATGGATGG - Intergenic
943482474 2:188437762-188437784 GTCTTTTGGGGGAATATGGATGG + Intronic
943538271 2:189180051-189180073 GTGTCTGGGGGGAAGGGTTAGGG - Intergenic
943549861 2:189325166-189325188 GTGGGGTGGGGGAAGGGGGAGGG + Intergenic
945120661 2:206454229-206454251 AAGTCTTGGTGGAAGGTGAAGGG + Intronic
945754923 2:213834137-213834159 GAGTCATGGTGGAAGGTGAAAGG - Intronic
945874094 2:215258956-215258978 GTGTGGTGGGGGCAGGGGGAAGG + Intergenic
946211394 2:218150126-218150148 GTGGCTTGGGTGAAGGTGATGGG - Intergenic
946283422 2:218683726-218683748 GTGGGGTGGGGGAAGGGGGAGGG - Intronic
946320649 2:218952307-218952329 CTGTGATGGTGGAAGGTGGAGGG + Intergenic
946756682 2:222954159-222954181 ATCTCTTGGGGTAAGGTGGGAGG - Intergenic
946834955 2:223763509-223763531 GGGAGTTGGGGGCAGGTGGAGGG - Intronic
947080344 2:226388933-226388955 GGGTTTTAGAGGAAGGTGGAAGG + Intergenic
947206971 2:227669722-227669744 GTGTCTAGTGGGCAGGTGCAGGG + Intergenic
947459462 2:230290671-230290693 TTGGCTTGAGGGAAGGAGGAAGG + Intronic
947546375 2:231013200-231013222 TTGCCTTGGGGGAAGGGGGATGG - Intronic
947736060 2:232456179-232456201 ATGTCTTGGGGGCAGCAGGAGGG - Exonic
948178686 2:235963073-235963095 GTCTCTTAGAGGAAGGTGGGTGG + Intronic
948720932 2:239899424-239899446 GTGTGATGGAGGAATGTGGAGGG + Intronic
948754088 2:240149223-240149245 GTGTCTTGGGAGAGGCAGGAAGG - Intergenic
1168976389 20:1969268-1969290 GGGTGCTGGGGGGAGGTGGAGGG - Intergenic
1169316670 20:4597470-4597492 GTCTTTTGTGGGAACGTGGATGG + Intergenic
1169529317 20:6467131-6467153 GTGTCTTGTGGGAAGCAGGGAGG + Intergenic
1169891533 20:10458512-10458534 CTGTTGTGGGGGAAGGGGGAGGG - Intronic
1170607036 20:17882323-17882345 GAGACTTGGGGGAAGGTAGCAGG - Intergenic
1170629357 20:18055085-18055107 GTGTGCTGGGGGAAGGGGGGCGG - Intronic
1170765064 20:19282798-19282820 GTGTTTTGGGGGCAGGTGGTTGG + Intronic
1170811594 20:19678646-19678668 GTGTCCGGGAGGGAGGTGGAGGG - Intronic
1171142630 20:22756013-22756035 GTTTATTGGGGGTGGGTGGATGG + Intergenic
1171261669 20:23739511-23739533 TTGTCTTGTGGGAAGGTTTAAGG - Intergenic
1171803180 20:29646796-29646818 GTGGGTTGGGGGGAGGGGGAAGG + Intergenic
1172608217 20:36230067-36230089 GTGGGGTGGGGGAAGGGGGAAGG - Exonic
1172945685 20:38686795-38686817 GGGTCTGGGGGGTAGGCGGATGG + Intergenic
1172946106 20:38690682-38690704 GTGTGTTGGGGGGAGGGGGAAGG + Intergenic
1172989971 20:39028148-39028170 GTGGCTTAGGGGAGGTTGGAGGG + Intronic
1174339624 20:49887720-49887742 GTGTCTAGGGAGGAGGTGGGAGG - Intronic
1174898635 20:54475877-54475899 GTGGCTCTGGGGAGGGTGGAGGG - Exonic
1175189333 20:57200455-57200477 GTGTCTGGGGGGAATGATGAGGG + Intronic
1175219544 20:57409032-57409054 CTGTCTTGGGGGTTGGTGGAGGG + Exonic
1175771427 20:61627061-61627083 GTGTTTTGGAGGAGGGTGGGTGG + Intronic
1176372868 21:6073139-6073161 GTGTGTTGGGGGGGGGTGGGGGG - Intergenic
1177170761 21:17653137-17653159 GGGGCTTGGGGGAAAGGGGAGGG + Intergenic
1177261112 21:18731806-18731828 GGGTATTGGGGGCAGGTAGAGGG - Intergenic
1177578131 21:22984468-22984490 GTGTCTAGGGAGAAACTGGATGG - Intergenic
1178138076 21:29650800-29650822 GTGGCTGTGGGGAAGGTGGCTGG - Intronic
1178258782 21:31079710-31079732 GTGACTTGGGAGATAGTGGAGGG - Intergenic
1178607910 21:34055469-34055491 TGGTCTTGGGGGCAGATGGAAGG + Intergenic
1178696622 21:34798202-34798224 GTGTGTTGGGGGAACGGGGCGGG - Intronic
1178969396 21:37158445-37158467 ATGTTTGGGGTGAAGGTGGAAGG - Intronic
1179750609 21:43465104-43465126 GTGTGTTGGGGGGGGGTGGGGGG + Intergenic
1179953453 21:44724423-44724445 GCCTCTTTGGGGAAGGTGGTGGG + Intergenic
1180631565 22:17233675-17233697 GTGTCTGGTAGGAAGGTGGCAGG - Intergenic
1180714310 22:17861042-17861064 GGCTCTTGGGGTAAGGTGGGAGG + Intronic
1181468739 22:23125295-23125317 GGGTCTTGGGGGCAGCGGGAGGG - Intronic
1182702458 22:32251555-32251577 GTCCCATGGTGGAAGGTGGAAGG - Intronic
1183423577 22:37725806-37725828 GTGTCTGGGAGGAAGGGGAAGGG - Exonic
1183929458 22:41227702-41227724 GTCTCGTGTGGGAGGGTGGATGG + Intronic
1183966571 22:41446210-41446232 GGGTCTGGAGGGAAGCTGGATGG + Intronic
1184729856 22:46366171-46366193 GGTTGTTGGGGGAAGGTGCAGGG + Intronic
1184777084 22:46628635-46628657 GTGTCTGAGGGGCAGGTGGAGGG + Intronic
1185189197 22:49423396-49423418 GTGTGTTGGGTGAAGGCAGAGGG + Intronic
1185189206 22:49423448-49423470 GTGTGTTGGGTGAAGGCAGAGGG + Intronic
1185336808 22:50274654-50274676 GGGTGCTGGGGGGAGGTGGAGGG - Intergenic
1185336868 22:50274780-50274802 GGGTGCTGGGGGGAGGTGGAGGG - Intergenic
949462646 3:4309614-4309636 GTGTGAAGGGGGAAGGTGGTGGG - Intronic
949524897 3:4893836-4893858 GTCTTTTGGGGGAACATGGATGG + Intergenic
950015334 3:9750930-9750952 GTGCCTTGGGCTCAGGTGGAGGG + Exonic
950242070 3:11379513-11379535 ATGGCTTGGGGGACTGTGGAAGG - Intronic
950471809 3:13190997-13191019 GTGTGTTGGGGGCAGGAGGAGGG - Intergenic
951535445 3:23736246-23736268 GGGATTTGGGGGAAGGTAGATGG + Intergenic
951744580 3:25962864-25962886 GGGACTTGGAGAAAGGTGGATGG + Intergenic
952037606 3:29221422-29221444 GGGTGTTGGGGGAAAGGGGAGGG - Intergenic
952106524 3:30076457-30076479 CTGTAATGGGGGAAGGGGGAAGG - Intergenic
953046874 3:39301357-39301379 GTGTGTTGGGGGGTGGAGGAAGG + Intergenic
953219262 3:40954010-40954032 GTGTGGTGGGGGGAGGGGGAGGG - Intergenic
953286200 3:41612275-41612297 GTATTTTGAGGGAAGGAGGAGGG - Intronic
953418812 3:42739344-42739366 ATGTATTGGGGGAAGGAGGTGGG - Intronic
953922361 3:46960948-46960970 GTGGGTTGGGGGCATGTGGAGGG + Intronic
954134125 3:48574356-48574378 CTGTCTAGGGGGATGGTGGGTGG - Intronic
954424087 3:50434282-50434304 GTGTTTTGGGGGCAGGGGGGCGG - Intronic
954608936 3:51934126-51934148 GTGACCTGGGGGAGGGTGGCAGG - Intronic
955162638 3:56479791-56479813 GTGGGGTGGGGGAAGGGGGAGGG - Intergenic
955433964 3:58879732-58879754 GTGTCTTGGGGGTTGGTGGAGGG + Intronic
955496735 3:59541323-59541345 GTATATTGGGGGAGGGTGGTGGG + Intergenic
955845561 3:63159405-63159427 GTGGCATTGGGGAAGGTGGGTGG - Intergenic
956026885 3:64992673-64992695 GTGGGGTGGGGGAAGGTGAAGGG + Intergenic
956064968 3:65388417-65388439 CTGTCTTGGGGGGAGGGGGCAGG + Intronic
957148257 3:76452318-76452340 TTGTGTGGGGGGAAGGGGGAGGG - Intronic
957762971 3:84583683-84583705 GTGGGGTGGGGGAAGGGGGAGGG - Intergenic
957894447 3:86403309-86403331 GTGGGGTGGGGGAAGGGGGAGGG - Intergenic
957952282 3:87141901-87141923 GTGGATTGGGGGGAGGTGCAGGG - Intergenic
957980582 3:87504654-87504676 GTGGGGTGGGGGAAGGGGGAGGG - Intergenic
958166336 3:89882220-89882242 GTGGCATGGGGGAGGGGGGAGGG + Intergenic
958496909 3:94856545-94856567 GTCTTTTGGGGGAACATGGATGG - Intergenic
958782548 3:98560102-98560124 GTGTCATGGGAGCAGGGGGAGGG + Intronic
959017959 3:101157353-101157375 GTGGCTAGGGGGAAGGGAGATGG + Intergenic
959496000 3:107052628-107052650 ATGTTTTGGGGAAAGGGGGAGGG - Intergenic
960403895 3:117236432-117236454 GGGTGTTGGGAGAGGGTGGAAGG - Intergenic
960483283 3:118219533-118219555 GTGTGTTGGGGGAGGGGGCAGGG + Intergenic
960637273 3:119796037-119796059 GTGCCTTGGGGGAAAGTGAGAGG - Intronic
960863023 3:122171123-122171145 GTGGGGTGGGGGAAGGGGGAAGG - Intergenic
960875640 3:122292578-122292600 GTGTCTTGGTGCTAAGTGGAAGG - Intergenic
961454956 3:127019408-127019430 GTGTGTTGGGGCCAGGTGGGAGG + Intronic
961513768 3:127420300-127420322 CTGTCCTGGAGGAAGGTAGAGGG + Intergenic
962506641 3:136052969-136052991 ATGTCTTGTGGGACTGTGGATGG + Intronic
963706063 3:148689907-148689929 GTGGGGTGGGGGAAGGGGGAAGG - Intergenic
963783194 3:149507802-149507824 GTGTCATGGGAGAATGTGGCAGG - Intergenic
963953947 3:151232626-151232648 ATGTCTTGTGGGAATATGGATGG + Intronic
964102784 3:153006883-153006905 GTTTTCTGGGGGAATGTGGATGG - Intergenic
964351404 3:155806595-155806617 GTTCCTTGGGAGCAGGTGGAAGG - Intergenic
965094740 3:164210649-164210671 GTGGGGTGGGGGAAGGGGGAGGG - Intergenic
965371943 3:167873958-167873980 GTGTCTTGGAGGAAGGGGTTGGG - Intergenic
965981081 3:174691513-174691535 GAGTCTTGGCTGAAGGTTGATGG + Intronic
966689843 3:182730999-182731021 GTGGGTTGGGGGGAGGGGGAAGG + Intergenic
967279162 3:187805648-187805670 CTGGCTTGGGGGATGGAGGAAGG + Intergenic
968619239 4:1596402-1596424 GTACCTTTGGGGAAGGTGGGTGG - Intergenic
969495787 4:7525498-7525520 GCTGCTTGGGGGAAGGTGGAGGG - Intronic
969509987 4:7612286-7612308 GGGTCTGGGGGGAAGGAGAAGGG + Intronic
969533524 4:7742032-7742054 GGGTCTGGGGGACAGGTGGAAGG - Exonic
970667000 4:18348189-18348211 GTAACTGGGGGGCAGGTGGAAGG - Intergenic
970920470 4:21388662-21388684 GAGTGTTGGGGAAAAGTGGAGGG - Intronic
971075331 4:23141407-23141429 GTGTCTGGGGGGAAGGGTGGTGG + Intergenic
972073550 4:35054951-35054973 GTGGGGTGGGGGAAGGGGGAGGG - Intergenic
972268464 4:37485456-37485478 ATTCCATGGGGGAAGGTGGAAGG - Intronic
972503552 4:39698752-39698774 GTGGGTTGGGGGAAGGGGAAAGG + Intronic
972622592 4:40762966-40762988 ATGAACTGGGGGAAGGTGGAGGG - Intronic
973326182 4:48864720-48864742 GTGGAGTGGGGGAAGGGGGAGGG - Intergenic
975201630 4:71597091-71597113 ATCTCATGGTGGAAGGTGGAAGG - Intergenic
976280339 4:83320791-83320813 GTGTCTAGGGGGATGGTCGGTGG - Intronic
977140199 4:93361983-93362005 GTGGGGTGGGGGAAGGGGGAAGG - Intronic
977263099 4:94822130-94822152 ATCTCATGGTGGAAGGTGGATGG + Intronic
977360537 4:95998890-95998912 ATGTCTAGGGGGGAGGGGGAAGG + Intergenic
977665575 4:99643716-99643738 GTGGCTTGGGGGAAAGGGCAGGG - Intronic
977729815 4:100337892-100337914 GTCTTTTGGGGGAACATGGATGG + Intergenic
977732461 4:100370328-100370350 ATGTCCTGGGGGAAGGGGGAAGG + Intergenic
977809969 4:101347100-101347122 TATTCTTGGGGGAAGGGGGATGG + Exonic
977986759 4:103391378-103391400 GTGGGGTGGGGGAAGGGGGAGGG + Intergenic
978077602 4:104552603-104552625 TTTTCTTGGGGGAAGGGGGCTGG - Intergenic
979065502 4:116127068-116127090 GAGTCATGGTGGAAGGTGAAAGG - Intergenic
979191086 4:117859586-117859608 GTATTTTGTGGGAATGTGGATGG + Intergenic
979353192 4:119670213-119670235 TCATCTTGGGGAAAGGTGGAAGG - Intergenic
979420888 4:120503585-120503607 CTGTCATGGCGGAAGGTGAAGGG + Intergenic
979624415 4:122828566-122828588 ATGTCATGAGGGGAGGTGGAGGG + Intronic
979751712 4:124287596-124287618 GTGGGGTGGGGGAAGGGGGAGGG + Intergenic
980081033 4:128344347-128344369 GTGGGGTGGGGGAAGGGGGAGGG - Intergenic
980524818 4:133976105-133976127 CTCTGTTGGGGGAAGGTGGCAGG - Intergenic
981461897 4:145022503-145022525 GGGACTTGGGGGAAAGTGGGGGG + Intronic
982081751 4:151796971-151796993 GTGGCTTGGAAGAAGGTGGCAGG + Intergenic
983272917 4:165584161-165584183 GTGGGGTGGGGGAAGGGGGAGGG + Intergenic
983302298 4:165942297-165942319 GAGTCTTGGCGGAGGATGGAGGG - Intronic
983520992 4:168708939-168708961 GTTTGTTGTGGAAAGGTGGAGGG + Intronic
984217318 4:176930630-176930652 CAGTGTTGGGGGAAGCTGGATGG + Intergenic
985034980 4:185829553-185829575 GTGTCTAGTGGGAACGGGGATGG - Intronic
985055336 4:186031082-186031104 ATGACCTGGGGGAAGGTGAATGG - Intergenic
985491536 5:182538-182560 TTGTCTTGGGTGGAAGTGGAAGG - Exonic
985640726 5:1062397-1062419 GTGTCTTCGGGGACGATGGCTGG - Intronic
986161486 5:5233493-5233515 GTGGCCTGTTGGAAGGTGGAGGG - Intronic
986485870 5:8236353-8236375 CTGTTTTGGGGGAAGGAGGAGGG - Intergenic
986679046 5:10216881-10216903 GTGCCTTTGGGGAAGGTGGATGG - Intergenic
986766015 5:10927268-10927290 GTGGGTTGGGGGCAGGCGGAGGG + Intergenic
986806350 5:11312014-11312036 GTGTGTGGGGTGAAGGTGTATGG - Intronic
986962422 5:13231238-13231260 GTGACTTGGTGGAATGTGTAAGG - Intergenic
987162032 5:15154803-15154825 CAATCATGGGGGAAGGTGGAGGG + Intergenic
987597119 5:20016151-20016173 GTCTTTTGGGGGAACATGGATGG + Intronic
989601288 5:43203081-43203103 GGGGCTGGGGGGATGGTGGAAGG - Intronic
989690607 5:44138625-44138647 GTGTGTTGGGGGGAGGGGGAGGG + Intergenic
989745490 5:44824649-44824671 GTGGGGTGGGGGAAGGGGGAAGG - Intergenic
989964592 5:50452899-50452921 GTCTTTTGTGGGAAGATGGATGG - Intergenic
990521107 5:56582164-56582186 CTTTCTTGGGGGTTGGTGGAAGG - Intronic
992158967 5:73982090-73982112 GTGTCTTCGGGGGAGCTGGGAGG + Intergenic
992639329 5:78755247-78755269 TGGTGTTGGGGGAAGGTGGGAGG - Intronic
992950176 5:81850852-81850874 CTGTCGTGGGGGTGGGTGGACGG - Intergenic
992969756 5:82044165-82044187 CAGTCATGGGGGAAGGTGAAAGG + Intronic
993663042 5:90662753-90662775 GTGTGGTGGGGGGAGGGGGAAGG - Intronic
993730818 5:91420519-91420541 GTGGGGTGGGGGAAGGTGGGAGG + Intergenic
994729847 5:103479002-103479024 GTTTTTTGGGGGCAGGTGGGGGG - Intergenic
995154226 5:108891806-108891828 GTTGCGTGGGGGAAGGGGGAGGG - Intronic
995202462 5:109441757-109441779 GTGGGGTGGGGGGAGGTGGAGGG - Intergenic
995535056 5:113127155-113127177 ATGTCTTGTGGGAAGATGGATGG - Intronic
996012450 5:118495882-118495904 GTGGGGTGGGGGAAGGGGGAAGG + Intergenic
996256273 5:121408039-121408061 GTGGGGTGGGGGAAGGGGGAAGG - Intergenic
997087981 5:130823600-130823622 GTGGGTTGGGGGAGGGGGGAGGG + Intergenic
997876265 5:137550371-137550393 GTGGGGTGGGGGAAGGAGGAGGG + Intronic
997981849 5:138472591-138472613 CTGAATAGGGGGAAGGTGGAAGG - Intergenic
998403739 5:141862173-141862195 TTGCCCTGGGGGAAGGTGGCTGG + Intronic
998596051 5:143531620-143531642 CTGTCTTGGGGGCAGGGGGATGG - Intergenic
998820953 5:146057346-146057368 GTGTTGTGGGGAGAGGTGGAGGG - Intronic
999030881 5:148289919-148289941 GTGTGTTGGGGGAGGGGGGAGGG - Intergenic
999123849 5:149231414-149231436 GTGTGTTGGGGGATGGGGAATGG + Intronic
999301834 5:150496038-150496060 ATGCTTTGGAGGAAGGTGGATGG + Intronic
1000153552 5:158527854-158527876 GTGTCTGGGGGGATTGTGGAAGG + Intergenic
1000188594 5:158885947-158885969 GAGACTTGGGGGAAGTTGTAGGG - Intronic
1000743570 5:165001189-165001211 GTGACTTGAGGGAAGGTTCAAGG + Intergenic
1000964359 5:167637812-167637834 GTGGGTTGGGGGAAAGGGGAGGG + Intronic
1001085227 5:168695675-168695697 GTGTTTGGGGGGTAGGTGGGTGG + Intronic
1001350977 5:170964539-170964561 GTGGGGTGGGGGGAGGTGGAAGG - Intronic
1001476427 5:172054226-172054248 GTGTTTTGGGCAAAGGTGGTTGG - Intronic
1001486339 5:172122304-172122326 GAATCTTGGAGGATGGTGGATGG - Intronic
1001503379 5:172256283-172256305 GTGTGTTGGGGGCAGGTGTTGGG - Intronic
1001924473 5:175626405-175626427 GTGTCATGGGGGCACCTGGAGGG - Intergenic
1002466748 5:179412211-179412233 GTCGGTTGGGGGAGGGTGGAAGG - Intergenic
1002466898 5:179412554-179412576 GTCGGTTGGGGGAGGGTGGAAGG - Intergenic
1002576567 5:180177321-180177343 GTGTCTTTGGGGAAGCTGCTGGG - Intronic
1202772758 5_GL000208v1_random:26871-26893 GTGTGGTGGGGGGAGGTGGGAGG + Intergenic
1002831317 6:824087-824109 GTGTTGTGGGGGGAGGGGGAGGG - Intergenic
1003060992 6:2862296-2862318 GTCCCATGGTGGAAGGTGGAAGG - Intergenic
1003230896 6:4252819-4252841 GTGGGGTGGGGGAAGGGGGAAGG + Intergenic
1003516391 6:6822337-6822359 GTCTTTTGGGGGAAAGGGGATGG - Intergenic
1003649226 6:7943325-7943347 GTGGGGTGGGGGAAGGGGGAGGG - Intronic
1003734584 6:8864312-8864334 GGGGCTTGTTGGAAGGTGGAGGG + Intergenic
1003874441 6:10423629-10423651 GTGTGTTGGGGGAGGGGGGATGG + Intergenic
1004453767 6:15771895-15771917 GTGTCTTGGGGCATGGTGGGCGG + Intergenic
1004631000 6:17421227-17421249 GGGACTTGGGGAAAGGTGGGAGG + Intronic
1004796086 6:19086640-19086662 GTGACTTGGGGGAAGGGAAATGG - Intergenic
1005192294 6:23238673-23238695 GTTTGTTGGGTGAAGGTGGATGG + Intergenic
1006082714 6:31576673-31576695 TGGTCTTGGGGGAGGATGGATGG + Intronic
1006180880 6:32152752-32152774 GCGTCTTGGTGGGAGGTGGTGGG - Intronic
1006400485 6:33814498-33814520 AGGCCTTGGGGGAAGGTGGAGGG + Intergenic
1006604284 6:35244934-35244956 GTGAGTTGGGGAGAGGTGGAAGG - Intronic
1006984156 6:38166548-38166570 GTGCGGAGGGGGAAGGTGGAGGG - Intergenic
1007115626 6:39341190-39341212 GTGGCTGGGGAGAGGGTGGAAGG - Intronic
1007155836 6:39742404-39742426 GTGGGGTGGGGGAAGGGGGAGGG + Intergenic
1007170919 6:39862909-39862931 GTGCCATGTGGGAAGGTGGAAGG - Intronic
1007229221 6:40336790-40336812 GTGACTTGGGGGATAGTGGGTGG + Intergenic
1007231067 6:40348020-40348042 GTGTGCTGGGGGAAGGGGCAGGG + Intergenic
1007247366 6:40472188-40472210 GGGGCTGGAGGGAAGGTGGAGGG - Intronic
1007732322 6:43954699-43954721 GTGGGGTGGGGGAGGGTGGAGGG - Intergenic
1008400565 6:51058004-51058026 GTGTGGTGGGGGGAGGGGGAAGG - Intergenic
1009999233 6:70931183-70931205 GTGGGTTGGGGGGAGGGGGAAGG + Intronic
1010197972 6:73258842-73258864 GTGTCTTAGGGAAAGGCAGAAGG - Intronic
1010205331 6:73317503-73317525 GTGGCTTGGGGAAAAGGGGAAGG + Intergenic
1010251096 6:73708140-73708162 GTGGGATGGGGGAAGGGGGAAGG - Intronic
1010524311 6:76881466-76881488 GTATCTTGGGGTAAGGTAGGAGG + Intergenic
1010986520 6:82431424-82431446 GTGTTTTGGTGGGAAGTGGAAGG + Intergenic
1011779774 6:90774608-90774630 ATCTCATGGTGGAAGGTGGAAGG + Intergenic
1012957598 6:105587998-105588020 GCCTCTTGGGAGAAGGGGGAGGG - Intergenic
1013273673 6:108562887-108562909 CTGTCTTGGGGGAAGGGGCCAGG - Intronic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1013772023 6:113638432-113638454 GACTCTTTGGGGAAGGTAGAAGG - Intergenic
1014040800 6:116822710-116822732 GTGGGTTGGGGGAGGGGGGAGGG + Intronic
1014126685 6:117784022-117784044 AAGACTTGGGGGAAGGTGGTTGG - Intergenic
1014432892 6:121390414-121390436 GTGTCTAGTGGGATGTTGGAGGG - Intergenic
1015180091 6:130352062-130352084 GTGTGTTGGGGGGAGGGGGGAGG + Intronic
1015675765 6:135746497-135746519 GTGGGTCGGGGGAAGGGGGAGGG + Intergenic
1015677217 6:135763332-135763354 GAGTCATGGCGGAAGGTGAAAGG + Intergenic
1016370685 6:143371297-143371319 GTGTGTTGGGGGGCGGGGGAGGG - Intergenic
1016453138 6:144204030-144204052 GTGTTTTGTGGGAATGTGGCTGG - Intergenic
1016606802 6:145938292-145938314 ATCTCATGGTGGAAGGTGGAAGG - Intronic
1017387721 6:153905634-153905656 ATCTTTTGGGGGAAGATGGATGG + Intergenic
1017720593 6:157240828-157240850 GTGTTTTGGGGGAGGGCTGATGG + Intergenic
1018093591 6:160366005-160366027 GTGTCATGGGGGAACCTGGTGGG - Intronic
1018270732 6:162074479-162074501 GTGTGGTGGGGGGAGGGGGAGGG + Intronic
1019323597 7:426469-426491 GAGTGTTGGTGGAGGGTGGAGGG - Intergenic
1019351631 7:556762-556784 GTGTGTTTGGAGAAGGTGAAAGG - Intronic
1020267059 7:6567929-6567951 GTGTGTGGGGGGAAGGTGACGGG + Intergenic
1020331508 7:7022007-7022029 GTCTCTTGTGGGAATATGGATGG - Intergenic
1021303852 7:19006725-19006747 GTGGGGTGGGGGAAGGGGGAGGG + Intergenic
1021443010 7:20700712-20700734 GAGTCTTGGGGGCAAATGGAAGG + Intronic
1021809466 7:24389441-24389463 TTGTGTTGGGAGAAGGGGGAAGG - Intergenic
1022109130 7:27217285-27217307 GTGTGTGTGGGGAAGGTGGTGGG + Intergenic
1022449922 7:30504939-30504961 GAGTCTCGGCGGAAGGCGGAGGG - Intronic
1023472888 7:40544110-40544132 TTGGCTTGGGTGAAGGTGGGAGG + Intronic
1023797317 7:43804558-43804580 GGGTCTAGGGAGTAGGTGGATGG - Intronic
1023926754 7:44675076-44675098 GTGTCCTGGGGGGAGGGGGAGGG + Intronic
1023971754 7:44996762-44996784 GTGTGTTGGGGGAAAGTAGGGGG + Intergenic
1024482650 7:49880681-49880703 GTGGGATGGGGGAAGGGGGAAGG + Intronic
1026505741 7:70981057-70981079 CTGTCTTGGGGGCAGGAGCAGGG - Intergenic
1026735583 7:72946562-72946584 CGGTCTCGGGGAAAGGTGGAAGG - Intronic
1026785922 7:73301492-73301514 GGCTCTCGGGGAAAGGTGGAAGG - Intergenic
1026950041 7:74340842-74340864 GCTTCCTGGGGGAAGGTGGTTGG + Intronic
1027108142 7:75418450-75418472 GGCTCTCGGGGAAAGGTGGAAGG + Exonic
1027147340 7:75705174-75705196 GGGGCTTGGGGGAAGGGAGATGG - Intronic
1027988658 7:85329858-85329880 GTGGGTGGGGGGAGGGTGGAGGG - Intergenic
1028351098 7:89849692-89849714 ATGTCTTGGGTGTAGGTGGGTGG + Intergenic
1028893306 7:96012962-96012984 GTGACTTGGGGAAGGGTGGATGG + Intronic
1029418864 7:100461618-100461640 GGTTGTTAGGGGAAGGTGGAGGG - Intronic
1030177423 7:106669269-106669291 GTGACTTGGTTTAAGGTGGAAGG - Intergenic
1030349200 7:108464327-108464349 GTCTTTTGCGGGAACGTGGATGG + Intergenic
1030433988 7:109491414-109491436 GTGGGGTGGGGGAAGGGGGAGGG + Intergenic
1030715893 7:112806337-112806359 ATGTCTTGTGGGAATATGGATGG - Intergenic
1031052222 7:116955392-116955414 ATCCCTTGGTGGAAGGTGGAAGG + Intronic
1031240190 7:119228111-119228133 GTGACTTGGGGGAAGGACTATGG + Intergenic
1031784245 7:126008897-126008919 GTGTGTTGGGGGCAAGAGGAGGG - Intergenic
1032077059 7:128840975-128840997 GTGGCTGGGGGGCAGGAGGAGGG + Intronic
1032489547 7:132313949-132313971 GTGTCTGGGGGCAACGTGAAGGG - Intronic
1033061780 7:138116396-138116418 GTGTGTTGAGGGAAGGTTGGTGG - Intronic
1034859119 7:154581259-154581281 GTGCACTTGGGGAAGGTGGAGGG + Intronic
1034973412 7:155433534-155433556 CAGTCATGGTGGAAGGTGGAGGG - Intergenic
1035049702 7:155991730-155991752 GGGTCGTGGGGGAAGGAGGGAGG + Intergenic
1035074630 7:156169554-156169576 TTGTCCCGGGGGTAGGTGGAGGG + Intergenic
1035685256 8:1519606-1519628 GTGTCCATGGGGAAGGTGCATGG - Intronic
1036081120 8:5557085-5557107 GTGGGTGGGGGGAAGGGGGAGGG - Intergenic
1036634201 8:10537837-10537859 TTGCCTTGTGTGAAGGTGGACGG + Intronic
1036638205 8:10565609-10565631 GTGTGTCGGGGGCAGGTGGGAGG - Intergenic
1036951872 8:13148433-13148455 GTCTTTTGCGGGAATGTGGATGG - Intronic
1037207029 8:16335777-16335799 GTGGGTTGGGGGGAGGTGGGAGG - Intronic
1037488662 8:19375576-19375598 GTGGCTGGGAGGAAGGTGGCTGG + Intronic
1037674706 8:21043276-21043298 GTGGGGTGGTGGAAGGTGGAGGG - Intergenic
1037675034 8:21044014-21044036 GGGTGGTGGTGGAAGGTGGAGGG - Intergenic
1037810165 8:22082111-22082133 GTGGCCTGGAGGCAGGTGGAGGG - Exonic
1037904353 8:22706757-22706779 GGGTCGTGGGGGTAGGGGGAGGG + Intergenic
1038317574 8:26500893-26500915 GAGTGTTGGGGGAAGGTGTTAGG + Intronic
1039477192 8:37845381-37845403 GCTTGTTAGGGGAAGGTGGAGGG + Intronic
1040607997 8:48954044-48954066 GTGGGGTGGGGGAAGGGGGAGGG - Intergenic
1041340071 8:56835619-56835641 GTTTGTGGGGGGAAGGAGGAAGG - Intergenic
1041405915 8:57499096-57499118 ATGACTTGGGAGAAGGTAGATGG - Intergenic
1041901358 8:62986738-62986760 GAGTTTTGGGGGATGGGGGAGGG - Intronic
1042281019 8:67055859-67055881 ATGTCTTGGGGGTGGGGGGAGGG + Intronic
1042488456 8:69372421-69372443 GTGTCTTGGGGAAAGGGAGTGGG - Intergenic
1043333250 8:79142832-79142854 GTGGGGTGGGGGAAGGGGGAAGG - Intergenic
1045761044 8:105608022-105608044 ATGTCTTGTGGGAACATGGATGG + Intronic
1046471511 8:114681632-114681654 AACTCTTGGTGGAAGGTGGAAGG + Intergenic
1046499241 8:115054432-115054454 GTCTCTTGTGGGAACGTGGATGG - Intergenic
1046705405 8:117444456-117444478 TTGTGTTTGGAGAAGGTGGAAGG + Intergenic
1047196173 8:122723579-122723601 GGGGATTAGGGGAAGGTGGAAGG - Intergenic
1047766039 8:127990846-127990868 GTGTCTGTGAGGATGGTGGAGGG + Intergenic
1048288058 8:133157864-133157886 GTGTTCTGGGAGAAGGTGGATGG - Intergenic
1048559811 8:135522096-135522118 CTGTCATGGGGGCAGGGGGAGGG - Intronic
1048765274 8:137836820-137836842 CTGTGTTGGGGGAAGGGAGAGGG - Intergenic
1048862596 8:138735016-138735038 GTGGGTTGGGGGAAAGGGGAGGG + Intronic
1048986553 8:139738027-139738049 CTGGCTTGGGAGAAGCTGGAAGG - Intronic
1049005205 8:139850839-139850861 GTGATTTTTGGGAAGGTGGATGG - Intronic
1049291460 8:141805140-141805162 GTATCCTAGGGGAAGGAGGATGG + Intergenic
1049371963 8:142272265-142272287 GTGGCTAGGTGGAAGGAGGAAGG - Intronic
1049377030 8:142294153-142294175 GTGGCCAGAGGGAAGGTGGAGGG + Intronic
1049478011 8:142805846-142805868 CTGTCTTGGGAAAAGGGGGATGG + Intergenic
1049711228 8:144064233-144064255 GTGTCGTGGGGGAAGGGATATGG + Intergenic
1050181731 9:2930285-2930307 GTGTTTTGTGGGAATATGGATGG - Intergenic
1050387952 9:5110825-5110847 GTTTGTTCGGGGAAGGTGGGGGG + Intronic
1050497324 9:6258169-6258191 GTGGGGTGGGGGAAGGGGGAGGG - Intergenic
1050770791 9:9197204-9197226 GTGCTTTGGGGGAAAGTGTAAGG - Intronic
1050825262 9:9937075-9937097 TTGGGTTGGGGGAAGGGGGAGGG + Intronic
1051181128 9:14412985-14413007 GTGATTTGAGGGAAGGAGGAGGG - Intergenic
1051657545 9:19397325-19397347 GGGGGTTGGGGGAAGGTGGGAGG + Intergenic
1052492653 9:29188838-29188860 CTGTCTGGGAGGAAGGTGGCGGG - Intergenic
1053699543 9:40675859-40675881 GTGTGGTGGGGGGAGGGGGAGGG - Intergenic
1054310832 9:63475260-63475282 GTGTGGTGGGGGGAGGGGGAGGG - Intergenic
1054409621 9:64799411-64799433 GTGTGGTGGGGGGAGGGGGAGGG - Intergenic
1055111622 9:72565877-72565899 GTGTCTTGAGGGGAGCTGGTGGG - Intronic
1055117924 9:72625374-72625396 GTGATTTGGGGGAAGGTTTAAGG + Intronic
1055763238 9:79632461-79632483 GTGTCTGCCGGGAAAGTGGAGGG - Intronic
1056007134 9:82284882-82284904 CTGCCTCGGGGGAAGGTGGGTGG - Intergenic
1056480984 9:87005882-87005904 GTATCTTGGGGGTGTGTGGAGGG - Intergenic
1056541003 9:87571420-87571442 GTGTGTTGGGGGGTGGGGGATGG - Intronic
1056671388 9:88630712-88630734 GTCTTTTGTGGGAACGTGGATGG - Intergenic
1056764300 9:89435500-89435522 GTGAGTTGGGGAAAGGAGGAGGG - Intronic
1056793282 9:89639856-89639878 GGCTCTGGGGGGAAGGAGGATGG + Intergenic
1057204660 9:93164087-93164109 GTGTCCAGGGAGAAGCTGGATGG - Intergenic
1057594032 9:96399331-96399353 CTTTTTTGGGGGATGGTGGAGGG + Intronic
1058093555 9:100833033-100833055 GTGGGTGGGGGGAAGGAGGAGGG + Intergenic
1058214594 9:102218051-102218073 GTGGGTTGGGGGGAGGTGGGAGG - Intergenic
1058235816 9:102487842-102487864 GTGGGGTGGGGGAAGGGGGAGGG + Intergenic
1058840516 9:108903218-108903240 GTGGGGTGGGGGAGGGTGGAGGG - Intronic
1060434648 9:123583089-123583111 GTGACTTTGGGGAATGGGGAAGG - Intronic
1060439576 9:123626349-123626371 GTGTCTGGGGGGAGAGGGGATGG + Intronic
1061183567 9:129038732-129038754 GAGGCTGGGGGGAAGGTGGGTGG + Intronic
1061231395 9:129317949-129317971 GTCTCCTGGGGGCTGGTGGAGGG - Intergenic
1061537279 9:131257972-131257994 GTATCTGGGGGGCAGGAGGATGG - Intergenic
1061643566 9:131980072-131980094 ATTTCTTGGGGGATGGGGGAAGG + Intronic
1061841798 9:133362793-133362815 GTAGCTTGAGGCAAGGTGGAGGG - Exonic
1062122493 9:134841279-134841301 TTGTCTTGGGGGAAGTTGACGGG + Intronic
1062479353 9:136744286-136744308 CTCTCTTGGGGGAAGGGGGTGGG - Intronic
1062515773 9:136934710-136934732 GTGTCACTGTGGAAGGTGGAAGG - Intronic
1062640439 9:137515785-137515807 GGGATTTGGGGGAAGGGGGATGG - Intronic
1062691372 9:137843526-137843548 GTCTTTTGTGGGAACGTGGATGG - Intronic
1203455228 Un_GL000219v1:160822-160844 GTGGGTTGGGGGAAGGGGGCAGG - Intergenic
1186057932 X:5671338-5671360 GGGGCTTGGGGAAATGTGGAAGG - Intergenic
1186062110 X:5720111-5720133 GTGGCGTGGGGGAAGGGGGGAGG - Intergenic
1186272395 X:7902762-7902784 GAGTCTTGGGGCAATGAGGACGG + Intronic
1186438511 X:9564772-9564794 GTGTATTGGTCGAAGGTGGGAGG + Intronic
1186477350 X:9867831-9867853 GTGTGGTGGGGGAAGGCTGATGG + Intronic
1186515689 X:10164815-10164837 GTGTCATGTGGGAATGTGCATGG - Intronic
1186612313 X:11149457-11149479 GTGTGTTGGGGGAGGGGGGCAGG + Intronic
1186647254 X:11520303-11520325 GTGGGGTGGGGGAAGGGGGAGGG - Intronic
1187769883 X:22683146-22683168 GTGGGGTGGGGGAAGGGGGAAGG + Intergenic
1187988548 X:24842980-24843002 GTGTATTGGGGGAGGGAGGCAGG - Intronic
1188702031 X:33277114-33277136 ATGGATTGGGGGAAGGTGGCAGG - Intronic
1189202599 X:39210351-39210373 GTGTGTTTGTGGAAGGTGGTGGG + Intergenic
1190076373 X:47320267-47320289 GGGGCTTGAGGGAAGTTGGAGGG - Intergenic
1190296337 X:49029957-49029979 GTTCCTTTGGGGAAGGTGCAGGG + Exonic
1190518569 X:51251360-51251382 GTGTGTTGGGGGTCGGGGGAGGG - Intergenic
1190723671 X:53172153-53172175 GTGCCCTGGGGAAAGGGGGATGG + Intergenic
1191100965 X:56728161-56728183 GTTACTTGGAGGAAGGTAGAAGG + Intergenic
1191605975 X:63063163-63063185 GTGGGTTGGGGGGAGGTGGGAGG + Intergenic
1191762249 X:64658507-64658529 GTGGCATGGGGGGAGGGGGAGGG - Intergenic
1191932373 X:66388305-66388327 GTGGGGTGGGGGAAGGGGGAAGG - Intergenic
1192210940 X:69127292-69127314 GAGTCTTGGGGGACTCTGGATGG + Intergenic
1192233460 X:69281434-69281456 GTGTGTGGTGGGAAGGTGAAAGG - Intergenic
1192531318 X:71889159-71889181 TGGTGTTGGGGGAGGGTGGAGGG + Intergenic
1192906931 X:75561412-75561434 GTGGGGTGGGGGAAGGGGGAGGG - Intergenic
1193241228 X:79171973-79171995 GTGTCATGGTGGAAGCTGTATGG - Exonic
1193579873 X:83251633-83251655 GTGTCCTTGGGGAAGGTGTATGG + Intergenic
1194337227 X:92663052-92663074 GTGGGGTGGGGGAAGGGGGAGGG + Intergenic
1194517112 X:94868237-94868259 GTGTGGTGGGGGAGGGGGGAGGG + Intergenic
1195162530 X:102184564-102184586 GTGAGTTGGGGGAGGGAGGAGGG + Intergenic
1195339373 X:103891259-103891281 GTGTGGTGGGGGAGGGTGGAGGG - Intergenic
1195596475 X:106696935-106696957 GTGTTTTGGGGGAGAGTTGAAGG + Intronic
1195790048 X:108574514-108574536 ATGTCTTGGGGGAATGCAGAAGG - Intronic
1195946177 X:110214644-110214666 GTGTTTTGGGGGAAGGAAAAAGG - Intronic
1196124650 X:112084397-112084419 GTGTCTGGGGGGAAGGGAGTTGG + Intergenic
1196632100 X:117953403-117953425 GTGGGGTGGGGGAAGGGGGAAGG + Intronic
1196656071 X:118218529-118218551 GAGTCTTGGTGGAAGGAGGGGGG - Intergenic
1197059511 X:122160719-122160741 GTGGGGTGGGGGAAGGGGGAGGG - Intergenic
1197115202 X:122823828-122823850 GTCTGTTGGGGGTGGGTGGAAGG + Intergenic
1197212597 X:123840575-123840597 GTGTTTTGGGGGGAGGGAGAGGG - Intergenic
1197276933 X:124490226-124490248 ATGTCTTTGGGTGAGGTGGAGGG + Intronic
1197525475 X:127556847-127556869 GGGACTTGGGGGAAAGTGTAAGG - Intergenic
1197915612 X:131531010-131531032 GTATCATGGTGGAAGGTGAAGGG - Intergenic
1198796507 X:140402353-140402375 GTCTTTTGTGGGAATGTGGATGG + Intergenic
1198811690 X:140542247-140542269 GGGTTTTGGGGGAAGTAGGAAGG + Intergenic
1200698083 Y:6378813-6378835 GTGGGGTGGGGGGAGGTGGAGGG - Intergenic
1200986012 Y:9304072-9304094 TGGTCTTGTGGGAGGGTGGAGGG - Intergenic
1201036029 Y:9785886-9785908 GTGGGGTGGGGGGAGGTGGAGGG + Intergenic
1201651294 Y:16290570-16290592 GTGGGTTGGGGGAGGGGGGAGGG - Intergenic
1201721065 Y:17097926-17097948 GTGTGGTGGGGGAGGGGGGAGGG - Intergenic
1201932387 Y:19365287-19365309 GGGCCATGGGGGAAAGTGGAGGG + Intergenic
1202115717 Y:21467719-21467741 GTGTCCTGGGGAAAGGGGGTCGG - Intergenic
1202124573 Y:21556829-21556851 TGGTCTTGTGGGAGGGTGGAGGG + Intergenic
1202154435 Y:21872551-21872573 TGGTCTTGTGGGAGGGTGGAGGG - Intergenic