ID: 1080008288

View in Genome Browser
Species Human (GRCh38)
Location 11:27432248-27432270
Sequence GGGGAGAGAAGGTGTTCAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 359
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 328}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080008288 Original CRISPR GGGGAGAGAAGGTGTTCAAG TGG (reversed) Intronic
901763308 1:11484569-11484591 GGGGAGAGAAGATGCTGGAGAGG + Intronic
902559812 1:17270414-17270436 AGGGACAGAGGGGGTTCAAGAGG + Intronic
904395712 1:30220087-30220109 GGGGAGAGAAGGTTTCAGAGAGG + Intergenic
906431700 1:45760537-45760559 GGCGGGAGAAGGTGGTCTAGAGG + Intergenic
906469974 1:46120730-46120752 GGGGAGAGATTCTGTTAAAGAGG - Intronic
907804999 1:57810093-57810115 GGGGAGAGAAGGTTTTAACAGGG - Intronic
908825401 1:68128117-68128139 GGGTAGAGAAGGCATTAAAGGGG + Intronic
910012340 1:82480940-82480962 AGGGAGAGAAGGATTCCAAGAGG + Intergenic
910023690 1:82623484-82623506 GGGAAGGTGAGGTGTTCAAGGGG - Intergenic
910240373 1:85079806-85079828 GGAGAGAGGAGAGGTTCAAGAGG - Intronic
911664031 1:100534215-100534237 GGGCAGAGCAGGTGTTCAAAAGG - Intergenic
912183161 1:107242737-107242759 AGGGAGAGGAGGTGGTCGAGTGG - Intronic
914813460 1:151046610-151046632 GAGGAGAGAAGTGGTTCAGGGGG - Intronic
915465249 1:156093835-156093857 TGGGTGAGAGGGTGTTCAAGAGG - Intronic
915631471 1:157156164-157156186 GGAGGGAGAAGCTGTGCAAGGGG + Intergenic
915722487 1:157994677-157994699 GGGGAGGGAAGGAGTTCAGCAGG - Intronic
917510708 1:175667113-175667135 AGGAAGAGCAGGTTTTCAAGTGG - Intronic
918623420 1:186631335-186631357 GTGGAGAGCATGTGATCAAGGGG + Intergenic
918981794 1:191570992-191571014 GGGGAGAGAAAGAGAGCAAGCGG - Intergenic
918994427 1:191738509-191738531 GCGGAGAGAAAATGTGCAAGTGG - Intergenic
920493760 1:206439462-206439484 GGGAAGAGAGGCTGTGCAAGAGG - Intronic
920658042 1:207891013-207891035 GGGGAGCGGGGGTGCTCAAGGGG - Intronic
920720660 1:208383783-208383805 GGGGAAAGCAGGTATTCAATAGG - Intergenic
920855140 1:209655847-209655869 GGAGAGAGAAGAGGTTCAGGGGG + Intergenic
920956930 1:210628168-210628190 GAGGAGAAAAAGTATTCAAGGGG + Intronic
921053514 1:211527341-211527363 AGGGAGAGAAGAGGTTCCAGCGG - Intergenic
921400569 1:214718534-214718556 TGGAAGAGAAGCTATTCAAGAGG + Intergenic
921463460 1:215456947-215456969 GGGGGTAGAAGGTTTTCAAAAGG - Intergenic
922781505 1:228256570-228256592 GGGGAGAGAAGGCCTGGAAGGGG - Intronic
922781895 1:228259419-228259441 GGGGAGAGAAGGCCTGGAAGGGG - Intronic
1063720921 10:8580625-8580647 GGAGACAGGAGGTGTTCAAGGGG - Intergenic
1065159146 10:22901048-22901070 GGGGAGAGAGAGAGTTCAAATGG + Intergenic
1065896653 10:30168687-30168709 GGGGAGAGAAGGTGCTGATTAGG - Intergenic
1068810609 10:61251658-61251680 GAGGAGAGAAAGTATTTAAGGGG + Intergenic
1068876571 10:62003155-62003177 GGTGGGAGGAGGTGTTCAAAAGG + Intronic
1069199454 10:65594431-65594453 GGGAAGAGAAGCTGAGCAAGTGG + Intergenic
1069875738 10:71561883-71561905 GGGCAGAGAAGTGGGTCAAGAGG + Intronic
1069900572 10:71704601-71704623 GGGGAGAGCAGGGGATGAAGGGG + Intronic
1070350296 10:75585144-75585166 GGTGAGAGAAAGGGTACAAGCGG - Intronic
1072468046 10:95685732-95685754 AGAGAGAGAGGGTGGTCAAGGGG - Intronic
1072475789 10:95758588-95758610 AGGGAGAGAAGGTGATGCAGAGG - Intronic
1072853269 10:98920091-98920113 GGGGTCAGAAGGTGTGGAAGTGG - Intronic
1074559429 10:114521906-114521928 GGGGAGAGAAGATGGCCTAGGGG + Intronic
1074847353 10:117410092-117410114 AGGGTGAGTAGGTGTTTAAGTGG + Intergenic
1075197489 10:120373280-120373302 GGTGAGTGAAAGTGTTCAAAGGG - Intergenic
1075324970 10:121524262-121524284 GGGGAGTGGAGGTGGTTAAGAGG - Intronic
1075429442 10:122368349-122368371 GGGGAAAGAAGGTCTTTAAGAGG - Intergenic
1075584716 10:123649234-123649256 GGGGAAAGAAGGTGTCAGAGAGG + Intergenic
1076195301 10:128513339-128513361 AGGGAGAGAAGATGGTCATGAGG - Intergenic
1077982521 11:7315019-7315041 GTGGAGAGAAGGTGTCCCACAGG - Intronic
1078623065 11:12926533-12926555 AAGGAAATAAGGTGTTCAAGAGG + Intronic
1080008288 11:27432248-27432270 GGGGAGAGAAGGTGTTCAAGTGG - Intronic
1081226448 11:40528994-40529016 GGGGAGAGTTGCTGTTCAATTGG + Intronic
1081995105 11:47359083-47359105 GGGGAGAGAAGGAGTGCAGAGGG + Intronic
1083428073 11:62599476-62599498 TGGGTGAGAAGGGGTTAAAGAGG - Intronic
1083443184 11:62690225-62690247 GGGGACACAGGGTGTTCAAATGG + Intergenic
1084224523 11:67707479-67707501 GGAGAGAGAAGCTGTCCAACAGG - Intergenic
1084262360 11:67987416-67987438 GGAGAGAGAAGCTGTCCAACAGG - Intergenic
1084750998 11:71204502-71204524 GGGGAGAGGAGGTGAGCAAGCGG - Intronic
1085652997 11:78285447-78285469 GTGGAGAGAAGGTGTTGTGGTGG - Intronic
1088322349 11:108567156-108567178 GGGAAGAGAAGGAAGTCAAGTGG + Intronic
1089670903 11:120056402-120056424 GGGGAGAGAAAGAAATCAAGTGG + Intergenic
1089849347 11:121482836-121482858 GGGGAGAGAAGGTGCTAGCGCGG + Intronic
1090393613 11:126405428-126405450 AGGGAGGGAAGGTGTTTAAATGG - Intronic
1090855169 11:130604699-130604721 GGGGAAAGAAGGTTATGAAGAGG + Intergenic
1090861867 11:130661241-130661263 GGGGAGGGGAGGTTTTCAGGGGG - Intergenic
1091233737 11:134005327-134005349 GGGGAGAGAGGGTCTCTAAGAGG - Intergenic
1091402491 12:189378-189400 GGGGAGAGAAGGAGGCCCAGGGG - Intergenic
1091805348 12:3352160-3352182 GTGGAGAGAGGGTCTTCAAAAGG - Intergenic
1092016123 12:5160425-5160447 GGGGAGAGAATGTGTTTGTGGGG + Intergenic
1092103736 12:5905907-5905929 GGGGAGAGAAGGTGAGAGAGAGG - Intronic
1094094810 12:26691682-26691704 CAGCAGAGAAGGTGTTCTAGGGG - Intronic
1094695140 12:32810511-32810533 GGTGTGAGAAAGTGTTCAAAAGG - Intronic
1096282252 12:50266423-50266445 GAGGTGGGAAGATGTTCAAGAGG - Intronic
1096674027 12:53216996-53217018 GAAGGGAGAAGGTGTTCATGAGG - Intronic
1096686277 12:53290290-53290312 AGGGAGAGATGGTGATCACGTGG + Intronic
1096908924 12:54962710-54962732 GGGCAGAGAATGTGTGCAACAGG + Exonic
1100052408 12:90464613-90464635 GCGGAAAGAAGGTGTTAAGGAGG - Intergenic
1101915543 12:108892993-108893015 GGGGAGTGAAGTTCTTCCAGCGG + Exonic
1102397234 12:112597189-112597211 GAGAAAAGACGGTGTTCAAGAGG + Intronic
1102596599 12:113997518-113997540 GGTGAGAGAAGGGGTTTCAGAGG + Intergenic
1103011735 12:117463279-117463301 GGGGAGAGAACTTGTTTCAGCGG - Exonic
1104726146 12:131076889-131076911 GGGGAGAGCAGGTGGGCATGAGG + Intronic
1106864578 13:33949235-33949257 GGAGAGAGAATGAGTGCAAGTGG - Intronic
1107728877 13:43328214-43328236 GAGGAGAGAACCTGTTCCAGTGG + Intronic
1108530544 13:51323501-51323523 GGGCAGAAAAGGTTTTCAGGAGG - Intergenic
1108862896 13:54884024-54884046 GGAGAGAGAAGGAGAGCAAGTGG - Intergenic
1109307503 13:60657003-60657025 GGGAAGTAAAGGTCTTCAAGAGG - Intergenic
1109424975 13:62156410-62156432 TGGGATAGTAGGTGTCCAAGAGG - Intergenic
1110897088 13:80767916-80767938 GAGGAGAGAATGTGTCCAAAAGG - Intergenic
1111998263 13:95186321-95186343 GGGGAGAGACGGAGTTGAATTGG + Intronic
1114358726 14:21945618-21945640 GGGGAGAGGAAGTGTTCTATAGG - Intergenic
1114524250 14:23358649-23358671 GGGGAAAGAATGTGTTGGAGAGG - Intronic
1114803405 14:25805403-25805425 GGAAAGAAAAGGTGTTCCAGAGG - Intergenic
1114923745 14:27366386-27366408 GAAGAGAGATGTTGTTCAAGGGG + Intergenic
1116174337 14:41447864-41447886 GAGAAGAGAAGGTATTCAGGAGG + Intergenic
1116551724 14:46248463-46248485 GCTGATAGAAAGTGTTCAAGGGG - Intergenic
1117608987 14:57463338-57463360 GGGGAGAGAAAGAGTTGAATAGG - Intergenic
1118067567 14:62208344-62208366 GGTGAGAGAAAGTGAACAAGAGG + Intergenic
1119635731 14:76271795-76271817 GGGGAGAGAGCGTGCTCTAGGGG - Intergenic
1120546158 14:85813942-85813964 TGGCAGAGAAGGGGGTCAAGAGG + Intergenic
1122205819 14:100147485-100147507 GGGGACAGCAGGTGCTCAAGAGG - Intronic
1122403045 14:101478772-101478794 GGGGAGAGATAGTGTTGAAGTGG - Intergenic
1123062644 14:105601215-105601237 GGGGAGAGCTGGTGGTCATGAGG + Intergenic
1123931433 15:25173497-25173519 GGGGAGTGGAGGTGCTCCAGGGG + Intergenic
1124900338 15:33816829-33816851 GGGGTGAGAGGGAGGTCAAGAGG - Intronic
1125476310 15:40050290-40050312 TGGGTGAGAAAGTGTGCAAGGGG + Intergenic
1127012617 15:54646238-54646260 GGGGAGAAAAGTTATTCAATGGG + Intergenic
1127165986 15:56244778-56244800 GGGGAGGGCGGGTGTTCAACGGG - Intronic
1128657851 15:69475547-69475569 GGGGAGAGATGTTGGTCAAAGGG + Intergenic
1130322622 15:82853532-82853554 GGGGAGAAAAGGGGGTCAAGGGG + Intronic
1131983096 15:98015062-98015084 TGGGAGAGTAGGTCTTCAATAGG - Intergenic
1134649554 16:15898037-15898059 GGGGAGAGAAGGAGGGCAGGGGG - Intergenic
1135537119 16:23302742-23302764 GGGGCAAGAAGTTGTTCAAGAGG + Intronic
1136476783 16:30518515-30518537 GGGCAGAGAAGGGGTTCCAGGGG - Intronic
1138251953 16:55508570-55508592 GGGGAGAGATGGTTCTCCAGAGG - Intergenic
1139512317 16:67434494-67434516 AGGTAGAGAAGGGCTTCAAGAGG + Intronic
1140533186 16:75684364-75684386 GTGGAGGGAAGGTGTTTAAATGG + Intronic
1140934840 16:79660845-79660867 GCTGAGAGAAGGGGTTCATGAGG + Intergenic
1142854277 17:2721343-2721365 TGGGAGAGAGAGTGTTGAAGAGG - Intergenic
1142903807 17:3029342-3029364 GTGGAGAAAAGGTGTGTAAGAGG - Intronic
1143435850 17:6924422-6924444 AGGGAGAGATGGTGATCAAAGGG - Intronic
1143706134 17:8698826-8698848 GGGGAGAGGAGGAGTGGAAGTGG + Intergenic
1145912144 17:28548979-28549001 TGGGAGAGAGAGTGTTCAGGAGG - Intronic
1146491664 17:33287775-33287797 GGTGAGAGATGGAGTTCTAGAGG - Intronic
1147037825 17:37694954-37694976 TGGTAGAGAAGGAATTCAAGTGG + Intronic
1147160259 17:38565599-38565621 GGGGAGAGAGGGAGCTGAAGAGG - Intronic
1148145622 17:45362780-45362802 GGGGAGGGAAGGAGAGCAAGGGG + Intergenic
1149957843 17:61072905-61072927 GGGCAGAGAAGATTTTAAAGAGG - Intronic
1151453622 17:74213808-74213830 GGGGAGAGAAGGGGTCTGAGAGG - Intronic
1152259238 17:79257994-79258016 GGGGAGAGAAGGGGATAAAGGGG - Intronic
1156386028 18:36606089-36606111 GGGGAGAGGAGTTGTTCAGTGGG + Intronic
1157099813 18:44719333-44719355 CGAGAGAGAATGTGTGCAAGGGG + Intronic
1157327916 18:46682136-46682158 GGGGAGGGATGGTGATCATGTGG + Intronic
1158655767 18:59331657-59331679 GGGGATAGAAGGTTTTCTGGGGG - Intronic
1158855973 18:61543604-61543626 GGGGAGAGCAGGAGGTCAGGTGG - Intronic
1160150331 18:76392928-76392950 GGGGAGGGCAGGTGGTCAGGTGG + Intronic
1160150359 18:76392997-76393019 GGGGAGGGCAGGTGGTCAGGTGG + Intronic
1160150396 18:76393089-76393111 GGGGAGGGCAGGTGGTCAGGTGG + Intronic
1160150406 18:76393112-76393134 GGGGAGGGCAGGTGGTCAGGTGG + Intronic
1160150489 18:76393324-76393346 GGGGAGGGCAGGTGGTCAGGTGG + Intronic
1160150508 18:76393370-76393392 GGGGAGGGCAGGTGGTCAGGTGG + Intronic
1160150555 18:76393490-76393512 GGGGAGGGCAGGTGGTCAGGTGG + Intronic
1160150603 18:76393605-76393627 GGGGAGGGCAGGTGGTCAGGTGG + Intronic
1160150742 18:76393955-76393977 GGGGAGGGCAGGTGGTCAGGTGG + Intronic
1160150768 18:76394016-76394038 GGGGAGGGCAGGTGGTCAGGTGG + Intronic
1160150815 18:76394136-76394158 GGGGAGGGCAGGTGGTCAGGTGG + Intronic
1160150880 18:76394302-76394324 GGGGAGGGCAGGTGGTCAGGTGG + Intronic
1160150899 18:76394348-76394370 GGGGAGGGCAGGTGGTCAGGTGG + Intronic
1160150918 18:76394394-76394416 GGGGAGGGCAGGTGGTCAGGTGG + Intronic
1160150965 18:76394514-76394536 GGGGAGGGCAGGTGGTCAGGTGG + Intronic
1160151059 18:76394744-76394766 GGGGAGGGCAGGTGGTCAGGTGG + Intronic
1160669465 19:352504-352526 AGGGAGAGAAGGTGACCACGGGG + Intergenic
1161388489 19:4009148-4009170 GGGGAGGGAAGATGTGAAAGGGG - Intronic
1162103076 19:8352432-8352454 GAGGAGGGAAGTTGTTTAAGAGG - Intronic
1162248298 19:9421520-9421542 GGGGCAAGAAGGTTTTCATGGGG - Intronic
1164473478 19:28554886-28554908 GGGGAGAGAAGCTGTAGGAGAGG - Intergenic
1165964702 19:39566506-39566528 GGGGAGAGAAAGTTTTGGAGTGG + Intergenic
1166380855 19:42354504-42354526 GGGAGGAGGAGGGGTTCAAGAGG - Intronic
1167556195 19:50197477-50197499 GGGGAGAGAAGGAGCCCAAGCGG + Intronic
925304452 2:2838491-2838513 GGGGAGAGAATGAGTTCTATTGG + Intergenic
925705873 2:6684395-6684417 TGGGAGAGAAGGAGTACCAGTGG - Intergenic
925836814 2:7954144-7954166 GGGTAGAGAAGGGAATCAAGAGG + Intergenic
926482059 2:13411676-13411698 AAGAAGAGAAGGTGTTCAACAGG - Intergenic
926693233 2:15751859-15751881 GGGCAGAGAAAGTGCTCCAGGGG - Intergenic
927617996 2:24619985-24620007 GGGGAGAGAAGGTCAGGAAGAGG - Intronic
928279638 2:29934225-29934247 AGGAAGAGAAGATGTTCAACAGG - Intergenic
928594015 2:32843433-32843455 GAGGGGAGAGGGTGGTCAAGAGG - Intergenic
928654862 2:33440012-33440034 GAGGAGAGAATGTGTTCAAGAGG + Intronic
928857007 2:35814274-35814296 GAGGAGAGAAGGGGTTCGGGAGG - Intergenic
930662015 2:54063940-54063962 GGGGTGAGATGGTGTTGAAGGGG + Intronic
931920484 2:67009788-67009810 GGAGAGAGAAGGTGTGAAGGAGG + Intergenic
933122213 2:78553017-78553039 GTGGAGAGGAGGTGATCAATGGG + Intergenic
935129311 2:100249467-100249489 GGACAGACAATGTGTTCAAGAGG - Intergenic
935194903 2:100807462-100807484 GAGGAGAGAAGGTGGTCAGGTGG + Intergenic
935534048 2:104272375-104272397 GGGGTAAGAAGGTGTGCAAGAGG - Intergenic
936690428 2:114881390-114881412 TGGTAGATAAGGTGTTCAAATGG - Intronic
936938717 2:117861111-117861133 GGAGAAAGAAGGGGTTCAACAGG + Intergenic
937095922 2:119235110-119235132 GGGGAGAGGAGCAGTTCTAGGGG - Intronic
937311555 2:120906142-120906164 GGGCAGGCAAGGTGTTCAATAGG + Intronic
937482797 2:122280145-122280167 GGGGAGAGATGGGGTAGAAGGGG - Intergenic
941931427 2:170944137-170944159 GGGGATAGAAAGTATTGAAGTGG + Intronic
942315381 2:174692578-174692600 GGGGAAAGAAGGAGTTCCAAAGG + Intergenic
942991285 2:182206551-182206573 GGGGAGAGAAAGGGATGAAGAGG - Intronic
943677473 2:190730227-190730249 GGTGAGAGATGGTTTACAAGTGG + Intergenic
943762637 2:191626599-191626621 GGGTAGAGAAGGGATTCAATTGG - Intergenic
944352421 2:198744766-198744788 GGGGAGAAAAATTGGTCAAGCGG + Intergenic
944384049 2:199144339-199144361 GAGGAGAAAAAGTGTTCTAGAGG - Intergenic
944869633 2:203896917-203896939 GTGGAGAGAAGGTACTCCAGAGG + Intergenic
945749509 2:213763522-213763544 GGGGAGAGTTGCTGTTCAATTGG + Intronic
946073411 2:217053680-217053702 TGGGAGAGTAGCTGTTGAAGAGG - Intergenic
946827988 2:223698512-223698534 GTGGAGAGAAGGTAGTCATGGGG - Intergenic
946922173 2:224591453-224591475 AGAGATAGAAGGTGATCAAGGGG + Intergenic
947337467 2:229102429-229102451 GAAGAGAGAAGCTGATCAAGAGG + Intronic
947603632 2:231469527-231469549 TGAGAGAGAAGGTCTGCAAGGGG - Intronic
948201660 2:236133682-236133704 GGGGAGAGCAGGTTTTGAATAGG + Intergenic
948255460 2:236565274-236565296 GAGGAGACATGGTGTTGAAGAGG + Intergenic
948292712 2:236838146-236838168 GGAGAGAGAATGAGTGCAAGCGG - Intergenic
948548075 2:238746555-238746577 GGTGAGGGAAGGTTTTCTAGAGG - Intergenic
948945118 2:241215447-241215469 GGGCAGATCAGGTGTTCAGGGGG - Intronic
1168897112 20:1331257-1331279 GGCAGGAGAAGGTGTTCCAGGGG - Intronic
1170852983 20:20020817-20020839 GGAGTGGGAAGCTGTTCAAGAGG + Intronic
1171201007 20:23242201-23242223 GGGGAGGGAGGGTGCTGAAGAGG - Intergenic
1171768443 20:29302442-29302464 GAGTAGAGACGGGGTTCAAGTGG - Intergenic
1172048486 20:32098668-32098690 GGGGACAGAAGGACTTCAGGGGG - Intronic
1172353238 20:34260335-34260357 GGACAGAGAAGGTGGTCAGGTGG - Intronic
1172900041 20:38328050-38328072 GGGGTGAGAAGAAGTTGAAGCGG - Intronic
1173159050 20:40638962-40638984 GGGGAGAGGAGGTGGTAAAGGGG - Intergenic
1173232524 20:41211423-41211445 GGGGTGAGAAGTTGTTAGAGTGG - Intronic
1174096504 20:48093531-48093553 GGGGAGAGAAGGTGGCAGAGGGG + Intergenic
1174339321 20:49886236-49886258 GGGGAGAGACGGAGGTAAAGAGG - Intronic
1176409663 21:6441680-6441702 GGGGAGATAAGGAAATCAAGAGG - Intergenic
1176886214 21:14258415-14258437 GGGGAAAGAAGGTGATATAGAGG - Intergenic
1177498942 21:21925652-21925674 GAGGACAGAAGGTGTTTACGAGG + Intergenic
1177719297 21:24883751-24883773 GGAGAGAGAATGAGTGCAAGCGG - Intergenic
1179088826 21:38244754-38244776 GAGGAGACAAGGTTTTCCAGGGG - Intronic
1179685156 21:43050002-43050024 GGGGAGATAAGGAAATCAAGAGG - Intergenic
1180041692 21:45283433-45283455 GGGAAGAGAAGGTGGACGAGCGG - Exonic
1181496001 22:23287884-23287906 GGTGAGAGATGGTGTGCCAGAGG + Intronic
1183387678 22:37524482-37524504 GGGGAGAGAAGGGGTTGGGGAGG + Intergenic
1184037560 22:41925989-41926011 GGGGAGAGAAGGGCTTTAAGGGG - Intronic
1184533103 22:45069557-45069579 TGGGAGAGCAGGTGTTCCGGTGG - Intergenic
1184587748 22:45459272-45459294 GTGGAGACAGGGTGTTCAATGGG - Intergenic
952660982 3:35846452-35846474 TGGGAGACAAGGTCTTAAAGAGG - Intergenic
955573593 3:60333909-60333931 AGGGAGAGAAGTTGATCAACAGG - Intronic
957077763 3:75615238-75615260 GGAGAGAGAAGCTGTCCAACAGG - Intergenic
960993308 3:123325486-123325508 GGGGAGATGAGGAGTCCAAGCGG + Intronic
961096460 3:124160683-124160705 GGAGAAAGAAGGTGTTGGAGTGG - Intronic
961107046 3:124250949-124250971 AGGGAGAGAAGGTGGCAAAGGGG - Intronic
963189219 3:142450783-142450805 GTGGACAGAACATGTTCAAGTGG + Intronic
963601629 3:147384113-147384135 AGGGACAGTAGGTGTACAAGAGG + Intergenic
964108759 3:153067422-153067444 AGGGAGAGAAGGTACTCAAAGGG + Intergenic
964411325 3:156400757-156400779 GTGGAGAGAAGGTGTTCACTAGG - Intronic
964684117 3:159376141-159376163 GGGGAAAAAAGGTTTTCAGGAGG + Intronic
964835229 3:160930671-160930693 GCGGAGTGAAGGAGTTTAAGAGG + Intronic
965440521 3:168707387-168707409 GGGGAGAAAAGGTGTTCAAACGG - Intergenic
965817456 3:172651959-172651981 GGGAAGAGAAAGTGTTGCAGAGG + Intronic
966066024 3:175822966-175822988 GGGGACACAAGGTGTTCAGTGGG - Intergenic
969020844 4:4139245-4139267 GGAGAGAGAAGCTGTCCAACAGG - Intergenic
969530876 4:7729500-7729522 AGGGAGAGAGGGTGTTCCTGGGG + Intronic
969733008 4:8968179-8968201 GGAGAGAGAAGCTGTCCAACAGG + Intergenic
969792584 4:9502257-9502279 GGAGAGAGAAGCTGTCCAACAGG + Intergenic
970557428 4:17248762-17248784 TGGGAGAGAGGGCCTTCAAGTGG - Intergenic
971518371 4:27516838-27516860 GGAGGGGGAAGGAGTTCAAGGGG + Intergenic
972234644 4:37116870-37116892 AGGGAGGGAAGGGTTTCAAGAGG + Intergenic
972702007 4:41503370-41503392 GGGGAGGAAAGTTGCTCAAGTGG + Intronic
973968274 4:56185748-56185770 GGGGAGACAGGGTGCCCAAGGGG - Intronic
975894399 4:79070035-79070057 GGGTAGAGGAGGTGGTGAAGAGG + Intergenic
976079397 4:81338040-81338062 GGAGAGAGAATGAGTGCAAGCGG - Intergenic
976455791 4:85245910-85245932 GTGGAGAGAAGGAGTTTAACAGG - Intergenic
976627401 4:87201127-87201149 GTGGAAAGAAGATGTTCAATGGG + Intronic
978028593 4:103910266-103910288 GGAGACAGAAGGGGTTCAAAAGG - Intergenic
978112953 4:104984875-104984897 GGAGAGAGAATGTGTGCAGGAGG + Intergenic
979612614 4:122705057-122705079 GGTGAGAGCAGATGTGCAAGAGG - Intergenic
980190914 4:129523894-129523916 GGGGAGAGTAGGTGGGGAAGAGG + Intergenic
981723752 4:147826686-147826708 GAGGAGAGCAGGGGGTCAAGGGG - Intronic
982108128 4:152029020-152029042 GGGGACAGAATCTGTTCCAGTGG + Intergenic
982215992 4:153082931-153082953 GGGGAGAGAAGGGGGTGAAGGGG + Intergenic
984211831 4:176859340-176859362 GGGGAGTGGAGGAGTCCAAGAGG + Intergenic
984832668 4:183989976-183989998 AGAGAAAGAAGATGTTCAAGGGG - Intronic
985699280 5:1360922-1360944 GGGGTGAGATGGTGGCCAAGGGG + Intergenic
985923617 5:2998872-2998894 GGGGAGAGGAGGCCTTCATGAGG + Intergenic
986352246 5:6891458-6891480 GGTTAGAGAAGGTGGTAAAGGGG + Intergenic
988488235 5:31685160-31685182 GGAAAGAGAAGGGGGTCAAGCGG - Intronic
990330957 5:54724893-54724915 GGGGAGTTAAGCTGGTCAAGGGG - Intergenic
990438951 5:55824521-55824543 GTGGAGAAAAGGTGGTGAAGCGG + Intergenic
991612878 5:68466821-68466843 GGGGAGAGAAGGAGGGCAAGAGG - Intergenic
992901599 5:81301994-81302016 GGGGACCGAAGCTGTTCAAAAGG - Exonic
994869931 5:105334775-105334797 GGGGAGAGAAGTGGAGCAAGAGG - Intergenic
995860373 5:116634552-116634574 AGGGAGAGAATGTGTGCTAGAGG + Intergenic
996369316 5:122736384-122736406 GGGGAGGTAAGGCGGTCAAGTGG + Intergenic
996465456 5:123796940-123796962 GGGGAGAAAAGGTATACAAAAGG - Intergenic
996799192 5:127384055-127384077 GGGGAGAGAAGGTTTCCCAGAGG - Intronic
999143367 5:149377301-149377323 GGGGTGGGAAGGTGTCCAGGAGG - Intronic
1000107282 5:158072102-158072124 GGGGTGTGAAGGGGTTGAAGGGG + Intergenic
1000510474 5:162175143-162175165 AGGGAGAGAAGGCTTACAAGAGG + Intergenic
1000929181 5:167231014-167231036 GGAGAGAGAATGAGTGCAAGTGG - Intergenic
1002712948 5:181205853-181205875 GAGGAGAGAGGGTGTGGAAGCGG - Intergenic
1003163070 6:3652605-3652627 GCGGGGAGTTGGTGTTCAAGGGG - Intergenic
1003853458 6:10248659-10248681 AGGGAGAGGAAGTGCTCAAGGGG + Intergenic
1004213744 6:13681451-13681473 GGGAAGAAAAGGTGCTGAAGAGG + Intronic
1004238564 6:13897766-13897788 AGAGAGAGAAGGTGTTCCAAAGG - Intergenic
1004285040 6:14313826-14313848 TGGTAGAGAAGGTGGTCAGGCGG + Intergenic
1004465137 6:15878207-15878229 GTGGAGAGAAAGTGTTCTGGGGG + Intergenic
1004479315 6:16003747-16003769 GGGGAGAGAAGCTCTTGAAGGGG + Intergenic
1005012267 6:21347354-21347376 GAGGAGAGAAGGAGGCCAAGAGG + Intergenic
1005058015 6:21748327-21748349 GGGTTGAGAAGATGTTGAAGAGG - Intergenic
1006735584 6:36270461-36270483 TGGAAGAACAGGTGTTCAAGGGG + Exonic
1006838014 6:37010935-37010957 GGGGAGAGAAGGAGAAAAAGGGG - Intronic
1010085486 6:71912630-71912652 TGGTAAAGAAGGTGTTCAAGAGG + Intronic
1010160814 6:72852616-72852638 GTGGAGAGAAGGAGATGAAGGGG + Intronic
1011202804 6:84855833-84855855 GGAGAGAGAAGTTGGTCAAAGGG + Intergenic
1011514095 6:88133349-88133371 GCGGAGAGTGAGTGTTCAAGAGG - Intergenic
1012884273 6:104826827-104826849 GGGGAGAGAAGGGGTGGAATTGG - Intronic
1015220242 6:130796025-130796047 GGGGTCACAAGGTGTTCAACGGG + Intergenic
1017081972 6:150678265-150678287 AAGGAGAGATGTTGTTCAAGTGG - Intronic
1017442278 6:154475307-154475329 GGGGAGAGATGGTGGCCAGGAGG - Intronic
1018054255 6:160038105-160038127 GGGGAAGGAAGGTTTTCAAATGG - Intronic
1018624228 6:165762164-165762186 GGGAAGAGAAGTTTTTCAATAGG - Intronic
1019272658 7:159169-159191 GGGGAGGGAAGGTGGTCTAGTGG - Intergenic
1020308271 7:6851269-6851291 GGAGAGAGAAGCTGTCCAACAGG - Intergenic
1022089474 7:27098105-27098127 GGGGAGAGAAGGAGCTCCTGTGG + Intergenic
1023859155 7:44206798-44206820 GGAGAGTGAAGGCATTCAAGAGG - Intronic
1024007911 7:45241100-45241122 GGGAAGAGAGGGTGTCCCAGAGG + Intergenic
1024449236 7:49519799-49519821 GGTGTGGGAAGGTGTTGAAGTGG - Intergenic
1026849578 7:73716569-73716591 GAGGAGAGAAGGTGATCCAAAGG - Intronic
1027725198 7:81796511-81796533 CTGGAGAGAAGGTCTCCAAGAGG + Intergenic
1028244546 7:88461347-88461369 GGGAAAAGAATGTGTTTAAGTGG + Intergenic
1028288313 7:89032322-89032344 GGGGAGAGAATGAGTTAAGGGGG + Intronic
1029023835 7:97393310-97393332 AGGAAGAGAAGTTGTTCAACAGG - Intergenic
1029516414 7:101026191-101026213 GTGGAGTGAAGGTGCTCACGGGG + Intronic
1029593233 7:101521122-101521144 GGAGAGAGAATGTGTGCAGGGGG + Intronic
1030065036 7:105652891-105652913 GGGGAGGGAAGGTGCTCCTGAGG - Intronic
1030169687 7:106588846-106588868 GGTTAGAGGAGGTGCTCAAGGGG + Intergenic
1030464138 7:109878348-109878370 GGAGAGAGAAGGGGTTGAGGGGG - Intergenic
1032576700 7:133061934-133061956 GGGCAGAGAAGGTTTAAAAGGGG + Intronic
1035143401 7:156787236-156787258 GGGGAGAGAGGGTGGTCACAAGG - Intronic
1035770381 8:2142606-2142628 AGGGAGGGAGGGTGTCCAAGGGG - Intronic
1036015772 8:4782128-4782150 GGGGAGAGAGGTTGCTCAATGGG + Intronic
1036208645 8:6824312-6824334 AGGGAGAGAAGGGGGTGAAGGGG + Intronic
1036209604 8:6831625-6831647 GGGTTGGAAAGGTGTTCAAGGGG - Intronic
1037287969 8:17321142-17321164 GGGAAGAGAAGGTGGTGAAAAGG - Intronic
1037341708 8:17852614-17852636 GGTCAGAGAAGGTTTTCCAGAGG - Intergenic
1038231713 8:25706716-25706738 AGGAAGAGAAGCTGTTCAATGGG - Intergenic
1039148316 8:34475021-34475043 GGTGAGAAAAGGTGTTGATGTGG + Intergenic
1039427560 8:37498632-37498654 GGGGAGAGAATGAGTGCCAGCGG - Intergenic
1039866998 8:41513716-41513738 GGGGAAAGAAGCTGGTGAAGGGG - Intergenic
1041102649 8:54412221-54412243 GTGGGGAGAAGGTGTGCAGGAGG - Intergenic
1043508367 8:80924899-80924921 GGGGAGAGAAGGTAGGCCAGGGG + Intergenic
1044424368 8:92034064-92034086 GGGAAGAGAAGGGGTTAAAGAGG + Intronic
1045301461 8:100914291-100914313 GGGGAGAGAGGGTGCTCTACTGG - Intergenic
1047084593 8:121502438-121502460 GGGGAGAGAAGGTGGTCGGGAGG - Intergenic
1047228994 8:122980024-122980046 AGGAAGAGAAGGAGTTCAAGAGG - Intergenic
1047423290 8:124724913-124724935 GGGGAGACAAGATATTCACGTGG - Intronic
1048272547 8:133041142-133041164 GGGGAGATGATGTGGTCAAGGGG + Intronic
1048379499 8:133852604-133852626 GAGAAGAGAAGGTGATCAACAGG - Intergenic
1048382018 8:133873788-133873810 AGAGAGAGAAGGTGTTCAATGGG - Intergenic
1050306242 9:4308503-4308525 GGGAGGAGAGGGTGTTCAGGTGG - Intronic
1050396674 9:5205181-5205203 TTGGAGAAAAGGTGATCAAGAGG - Intergenic
1052347897 9:27428412-27428434 GGGGAGATAGGGTGTTCACAGGG + Intronic
1053158752 9:35799093-35799115 GCGGAGACACTGTGTTCAAGTGG + Intronic
1053331868 9:37218851-37218873 TGGGAAAGAAGGTGTTAGAGAGG + Intronic
1056488499 9:87082847-87082869 GGGCTGAGAAGGTGAGCAAGAGG - Intergenic
1058136650 9:101315305-101315327 GGGAAGAGAAGGGTTTCAAAGGG + Intronic
1058781273 9:108337868-108337890 GTGAAGGGAAGGTTTTCAAGAGG - Intergenic
1059756716 9:117300729-117300751 GGGGACAGAAGGTGGAGAAGTGG + Intronic
1062236932 9:135514837-135514859 GGGGAGGGCAGGTGTGCAGGTGG + Intergenic
1185648411 X:1631394-1631416 GGGTAGAGGAGGTGCTTAAGGGG - Intronic
1186329389 X:8515944-8515966 GGGGAGTGAGGATGTTCAATAGG + Intergenic
1186950534 X:14619559-14619581 AGGTAGAGAAGGTAGTCAAGTGG - Intronic
1187225588 X:17373346-17373368 CAGGAGAGAAAGGGTTCAAGGGG - Intergenic
1188262681 X:28038091-28038113 AGGGACAGATGGTGGTCAAGAGG + Intergenic
1189201001 X:39195573-39195595 TGGTAGAGAAGGTGTCCCAGAGG + Intergenic
1194411131 X:93559622-93559644 GGGGAGGGAAAGTATTCTAGAGG + Intergenic
1194660340 X:96624216-96624238 GGGGTCACAAGGTGTTCAATAGG - Intergenic
1194987987 X:100511999-100512021 AGGGAGAGAAGGTGAGGAAGTGG - Intergenic
1197162919 X:123344343-123344365 GCTGAGAGAAAGTCTTCAAGAGG - Intronic
1197730605 X:129806070-129806092 GGGAAGAGAGGGGGTCCAAGGGG + Exonic
1198666897 X:139034391-139034413 GGGGAGATAATGTGATCCAGAGG + Intronic