ID: 1080008864

View in Genome Browser
Species Human (GRCh38)
Location 11:27437542-27437564
Sequence GATCTAGTCCCTGTTCTTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 101}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080008864_1080008867 4 Left 1080008864 11:27437542-27437564 CCTGCAAGAACAGGGACTAGATC 0: 1
1: 0
2: 1
3: 6
4: 101
Right 1080008867 11:27437569-27437591 CTTCCAATCCTTGTAATGCTAGG 0: 1
1: 0
2: 0
3: 4
4: 111
1080008864_1080008870 17 Left 1080008864 11:27437542-27437564 CCTGCAAGAACAGGGACTAGATC 0: 1
1: 0
2: 1
3: 6
4: 101
Right 1080008870 11:27437582-27437604 TAATGCTAGGCATGAAAAGAAGG 0: 1
1: 0
2: 1
3: 26
4: 239
1080008864_1080008871 20 Left 1080008864 11:27437542-27437564 CCTGCAAGAACAGGGACTAGATC 0: 1
1: 0
2: 1
3: 6
4: 101
Right 1080008871 11:27437585-27437607 TGCTAGGCATGAAAAGAAGGTGG 0: 1
1: 0
2: 1
3: 46
4: 310

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080008864 Original CRISPR GATCTAGTCCCTGTTCTTGC AGG (reversed) Intronic
901133138 1:6975233-6975255 CATGTTGTCCCTGCTCTTGCGGG + Intronic
902427166 1:16333003-16333025 TTTCTAGTCTCTGCTCTTGCTGG + Intronic
905539220 1:38746820-38746842 GATCAAGTCCCTGCGCTTGTGGG - Intergenic
912342116 1:108926796-108926818 GATCTCGTTCCTGATCTTGGAGG - Intronic
912884649 1:113457596-113457618 GTGCTAGTTCCTGTTCTTGGTGG + Intronic
916171211 1:162002815-162002837 CCTCAATTCCCTGTTCTTGCTGG + Intronic
916758616 1:167796903-167796925 AATCTCGTCCATGATCTTGCCGG + Intergenic
918245296 1:182654160-182654182 AATCTTGGCCCTGCTCTTGCTGG - Intronic
920761275 1:208785894-208785916 CATCTTGTCCCTGTCCCTGCAGG + Intergenic
922240850 1:223754823-223754845 GATCTGCTCCCTGCACTTGCCGG - Intronic
923904464 1:238368171-238368193 TATCTAGGCACTGTTTTTGCAGG + Intergenic
1066622392 10:37371207-37371229 GATCTTGTCTCTTTTTTTGCTGG + Intronic
1070612888 10:77946291-77946313 AATGTAGTCCTTGTTCTTGGTGG + Intergenic
1070949550 10:80419917-80419939 GATATGGTCCCTGTTTTTGGAGG + Intronic
1073372962 10:103007189-103007211 GACCTACTCCCTGTTCGTACAGG - Intronic
1079261659 11:18888102-18888124 GATTTAAACCCAGTTCTTGCTGG + Intergenic
1080005004 11:27397394-27397416 GACCTAGTCCCTGCTCATGAGGG - Intronic
1080008864 11:27437542-27437564 GATCTAGTCCCTGTTCTTGCAGG - Intronic
1080822852 11:35824000-35824022 TGTCTACTCCCTCTTCTTGCAGG + Intergenic
1084893208 11:72247133-72247155 GATCAAGTCCAAGCTCTTGCTGG + Intergenic
1092169164 12:6362579-6362601 GTCCTAGTCCCAGCTCTTGCTGG - Intronic
1098296626 12:69010726-69010748 GATCTATGCCCTGATGTTGCTGG + Intergenic
1098511559 12:71320417-71320439 GATCTCCTCACTGTTCTTGTGGG - Intronic
1099163863 12:79277082-79277104 GAAATATTCCCTGGTCTTGCTGG + Intronic
1099948625 12:89274575-89274597 GATCCAGTACATTTTCTTGCTGG - Intergenic
1104615325 12:130263352-130263374 TCTTTAGTCCCTGTTCTTCCTGG - Intergenic
1106644543 13:31617932-31617954 GAGCTCATCCCTGTTCTTTCTGG - Intergenic
1109830163 13:67775672-67775694 CATCTAGTACATTTTCTTGCTGG + Intergenic
1112284012 13:98087964-98087986 GATCTAGTCCCTCATTTTACAGG - Intergenic
1119562516 14:75602405-75602427 GTTCTAATCCCTGGTCTTTCTGG + Intronic
1120002499 14:79318387-79318409 GATCTACTCCGTGTTGTTTCTGG - Intronic
1122233151 14:100317325-100317347 CATCTAGTGCCTCTTCCTGCAGG + Intergenic
1123811501 15:23931034-23931056 GATCTGCTCCCTGTTGCTGCTGG - Intergenic
1128564205 15:68689164-68689186 GATCTTCACCCTGTTCTTGTGGG - Intronic
1128830807 15:70766838-70766860 GTTCTCTTCCCTGTTCTGGCAGG - Intergenic
1130274891 15:82471272-82471294 AATCTAGTCCTTCATCTTGCTGG - Intergenic
1130467239 15:84198641-84198663 AATCTAGTCCTTCATCTTGCTGG - Intergenic
1130497023 15:84474895-84474917 AATCTAGTCCTTCATCTTGCTGG + Intergenic
1130589535 15:85203239-85203261 AATCTAGTCCTTCATCTTGCTGG - Intergenic
1131183449 15:90256042-90256064 TATCTAGTCCATGCTCTTCCTGG - Intronic
1132072269 15:98788714-98788736 GTCCTAATCCCTGTTCTGGCCGG + Intronic
1134855812 16:17518077-17518099 GCTTTAGTTCCTGTCCTTGCTGG - Intergenic
1135831094 16:25774094-25774116 GAACTAGTCCCTGCCCATGCAGG + Intronic
1139513985 16:67442724-67442746 GCTCAAGTGCCTGTCCTTGCTGG + Intronic
1140558383 16:75947733-75947755 GACTTAGTCCCTGTTCCTCCAGG - Intergenic
1141429308 16:83962974-83962996 GTTCTAGTCCCTGCTCCTCCTGG + Intronic
1143377122 17:6473374-6473396 GGTCCAGTCCCTGTTCTAGGAGG - Intronic
1144198187 17:12915984-12916006 GATTGAGCCCCTGTTTTTGCTGG + Exonic
1149699299 17:58641959-58641981 AATCAAGTCCCTGTTCTTTCTGG + Intronic
1153174843 18:2359278-2359300 GTTCTAGTCCCCATTCTTCCAGG - Intergenic
1156957935 18:42991541-42991563 CATCTCGTCCCTGTACATGCAGG - Intronic
1159560985 18:69994242-69994264 AATCTAGTCCCTGTGATGGCAGG + Intergenic
1160431009 18:78812528-78812550 GATCCAGTCCCTGTTCTCAAGGG - Intergenic
1160524715 18:79528485-79528507 GCTCCAGTCGCTGCTCTTGCTGG + Intronic
1166803026 19:45469598-45469620 GATCTAGTCCCTGGGCTCTCAGG + Intronic
1167140237 19:47645440-47645462 CATCTTGTCCTTGTTCTGGCAGG + Intronic
1167862422 19:52296544-52296566 TTTCTATTCCCTGTTCTTTCGGG - Intergenic
930660018 2:54044051-54044073 GATCTCGTCTCTGTCCTTGATGG - Intronic
938047991 2:128140370-128140392 GAACTTGTCCCTGTCCATGCAGG + Intronic
939147760 2:138436813-138436835 GACTTGGTCCCTGATCTTGCAGG - Intergenic
946363219 2:219232028-219232050 GACCTATTACCTGTTCTTGGTGG - Exonic
946682646 2:222233396-222233418 GATTCAGACCCTGTTCTTACAGG - Intronic
1168771354 20:419027-419049 GATCAAGTCACTGTTTTGGCAGG + Intronic
1169612021 20:7392141-7392163 GCTCTAGTCTCTTTTCTTCCTGG - Intergenic
1173844937 20:46182286-46182308 GATGCGGTCCCTGTCCTTGCTGG + Intronic
1179057915 21:37952937-37952959 GCTCTAGGCTCTGTTTTTGCTGG + Intronic
1181544117 22:23591369-23591391 CTTCCAGGCCCTGTTCTTGCTGG + Intergenic
1183599551 22:38832044-38832066 CCTCGACTCCCTGTTCTTGCTGG - Intronic
1184977464 22:48072886-48072908 GAACAAGTTCCTGCTCTTGCTGG + Intergenic
1185414265 22:50701150-50701172 GACATAGTCCCTGTGCGTGCAGG + Intergenic
950367652 3:12499367-12499389 GACCTAGTCCCTGTTCTTGAAGG + Intronic
952740489 3:36729345-36729367 GCTCTGGGCCATGTTCTTGCTGG + Intronic
957041408 3:75338229-75338251 GATGGACTCCCTGTTCCTGCGGG - Intergenic
964409216 3:156380815-156380837 GATCTGGTCCCTGATTTTGAGGG + Intronic
964955969 3:162356161-162356183 GATCTAGTCCCACTTCTTCCAGG + Intergenic
968665000 4:1816162-1816184 GCTCTCGTCCCTGCTCTTGGAGG - Intronic
969662068 4:8536217-8536239 GAAATAGGCCCTGTTCTTACGGG + Intergenic
969889808 4:10249419-10249441 GCTGAACTCCCTGTTCTTGCAGG + Intergenic
970158725 4:13167877-13167899 GATGTAGTCTCTATTCTTGAGGG - Intergenic
970201729 4:13616165-13616187 GACCTGGTCCCTGTTCTGGATGG + Intronic
975335882 4:73174506-73174528 GATCTTGTTCCAGTTCTTGGGGG - Intronic
975642913 4:76518267-76518289 AATGTAGTCCCTGCTCTTGGGGG - Intronic
982824727 4:159988440-159988462 GAGCTAGTTTCTATTCTTGCTGG - Intergenic
983907308 4:173197596-173197618 ATTCTAATCCCTGTTCTTGTGGG + Intronic
985176094 4:187203019-187203041 GATATGGACCCTGTTCTTGCTGG + Intergenic
992273335 5:75088697-75088719 GTTCTAGTCCTGGTTCTGGCTGG + Intronic
995310185 5:110701840-110701862 AACCTATTCCCTGTACTTGCTGG + Intronic
997128465 5:131252688-131252710 GATCTAGTGCCTCTTTTTGCAGG + Intronic
1001320071 5:170673546-170673568 GACCTAGTATCTGTTCTAGCTGG + Intronic
1005759075 6:28951081-28951103 GTTCAAGTCCCTGTTCGGGCGGG + Intergenic
1007109720 6:39306023-39306045 GACCCAGTCCCTGCTCTTGAGGG - Intronic
1007624731 6:43238299-43238321 GAACTAGTGCCTGTTCCTACTGG + Intergenic
1013301746 6:108810454-108810476 GATCTTCTCCCTGGTCTTACTGG - Intergenic
1015013391 6:128379118-128379140 GTTCTACTCCCTGTTCTTTTTGG + Intronic
1016050695 6:139527079-139527101 GATCTGGTCCAATTTCTTGCTGG + Intergenic
1018954528 6:168399726-168399748 GATCTGGTTCCTGTTTTTGTAGG - Intergenic
1019021864 6:168925608-168925630 GATCCTGAGCCTGTTCTTGCAGG + Intergenic
1022764769 7:33399435-33399457 GTCCTAGTCCCAGTTCTTTCTGG + Intronic
1027442644 7:78236497-78236519 GATACAGTCCTTGTTCTTGAGGG + Intronic
1027486890 7:78772641-78772663 GAACTATTCACTGTTCTTGCTGG + Intronic
1046145752 8:110156365-110156387 GATCTAGTCCCAACTCTTGTTGG - Intergenic
1049025357 8:139984563-139984585 GACCTGGTCCCTGTCCTTCCAGG - Intronic
1049514301 8:143045305-143045327 GACCTTGTCCCTGGTCCTGCTGG - Intronic
1051184850 9:14449585-14449607 CATATAATCCCTGTTCATGCTGG + Intergenic
1055379303 9:75688855-75688877 CATCTAGTCCCTGACCCTGCAGG - Intergenic
1062003987 9:134230247-134230269 GCTCCAGTCCCAGTTCTTGTTGG + Intergenic
1186271401 X:7892096-7892118 GTTCTGGTCCTTGTTCTGGCGGG + Intergenic
1187243293 X:17532381-17532403 GATATAGTCCCTGCCCTTGAAGG + Intronic
1201329144 Y:12799277-12799299 TGTCTAGTCCCTGTTCCTGCCGG + Intronic