ID: 1080009540

View in Genome Browser
Species Human (GRCh38)
Location 11:27443816-27443838
Sequence ATCCAACAGCAGCTGCTCTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 165}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080009538_1080009540 -3 Left 1080009538 11:27443796-27443818 CCATATTTGCCTGCAGTTAAATC 0: 1
1: 0
2: 2
3: 12
4: 156
Right 1080009540 11:27443816-27443838 ATCCAACAGCAGCTGCTCTATGG 0: 1
1: 0
2: 2
3: 12
4: 165
1080009537_1080009540 15 Left 1080009537 11:27443778-27443800 CCTTGTGGTAGTAAAAGGCCATA 0: 1
1: 0
2: 0
3: 7
4: 104
Right 1080009540 11:27443816-27443838 ATCCAACAGCAGCTGCTCTATGG 0: 1
1: 0
2: 2
3: 12
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080009540 Original CRISPR ATCCAACAGCAGCTGCTCTA TGG Intronic
902943325 1:19815888-19815910 ATACAACAGCTGTGGCTCTAAGG - Intergenic
903628266 1:24746171-24746193 GTCCAAGAGCACCTGCTCTTTGG - Intronic
904001232 1:27339952-27339974 GTCCCACAGCAGCTGCTCCATGG + Intergenic
908163361 1:61433904-61433926 ATTCAGCACCTGCTGCTCTATGG + Intronic
909840243 1:80311789-80311811 TTCCCACAGCAGTTGGTCTAGGG + Intergenic
911185391 1:94898815-94898837 ATCCAACAACAGCTGGGATAGGG - Intronic
912481935 1:109989059-109989081 CTACAACAGCAGCCACTCTAAGG - Intronic
916862974 1:168826067-168826089 ATCGAACATCAGCAGCTCTGCGG + Intergenic
917682654 1:177384146-177384168 AGCAAACCACAGCTGCTCTATGG - Intergenic
919876279 1:201871284-201871306 AGCCGACAGCACCTGTTCTATGG + Exonic
921774674 1:219082836-219082858 ATCCATCAGCAGCAGCTATATGG - Intergenic
921906964 1:220505417-220505439 TGTCAACAGCAGCAGCTCTAGGG + Intergenic
1063174057 10:3535808-3535830 ATCCAACAGCACCTTCTCAGTGG + Intergenic
1064346770 10:14539956-14539978 AGCCAACAGCAGCACATCTATGG + Intronic
1065453986 10:25887464-25887486 ATCAATCAGGAGCAGCTCTATGG - Intergenic
1069543669 10:69314156-69314178 ATCCAACAGAAGCTGCTAAAAGG + Intronic
1069589869 10:69635029-69635051 ATCCAACCACAGCAGCTCTATGG - Intergenic
1072963642 10:99953024-99953046 AACCAACAGCAATTGGTCTAGGG - Intronic
1073353343 10:102835196-102835218 ATCCCACAGGAGCTGCTGGAGGG - Intronic
1074777553 10:116777415-116777437 GGCCAGCAGCAGCTGCTCTGTGG - Intergenic
1074973543 10:118563454-118563476 ATCCAACAGCAAGCTCTCTAGGG - Intergenic
1075005940 10:118830200-118830222 AGCCAAGAGCAGCTGCTATCAGG + Intergenic
1075216306 10:120539237-120539259 CTCTAACAGCAGTGGCTCTAGGG - Intronic
1075230529 10:120672120-120672142 AGCCAACCGCAGCAGCCCTATGG + Intergenic
1075621441 10:123930915-123930937 TTCCCACAGCAGCTGATCTGAGG + Intronic
1076666270 10:132094733-132094755 CTCCCACAGCAGATGCTCTCTGG - Intergenic
1080009540 11:27443816-27443838 ATCCAACAGCAGCTGCTCTATGG + Intronic
1081062457 11:38497130-38497152 ATGCATCAGCACATGCTCTAGGG + Intergenic
1083659432 11:64245407-64245429 ACAGAACAGCAGCTGCTCTGGGG + Intronic
1088274058 11:108065650-108065672 ATCCCCCAGCAGCAGCTGTATGG - Intronic
1088914974 11:114220626-114220648 ATCCACCAGCACCTGGTCTGGGG - Intronic
1089806239 11:121093406-121093428 GATCAACAGCAGCTCCTCTAGGG + Intergenic
1092484721 12:8892685-8892707 ATCCAACAGCGTTTGCTCTGTGG + Intergenic
1096157675 12:49349625-49349647 CTTCAACAGCAGCTGCTTTCAGG + Exonic
1097471063 12:59991989-59992011 TTCCAAGAGCAGTTGCTCTGTGG - Intergenic
1108251451 13:48571971-48571993 ATCCAACAGCAGTTTTTATAGGG + Intergenic
1108528188 13:51303526-51303548 ACCCATCAGCAGCTGCTCTGTGG + Intergenic
1117407352 14:55417187-55417209 CTCCCACAGCTGCTGCTGTATGG - Intronic
1117747154 14:58881492-58881514 AGCCAAAAGCACCTGCACTATGG - Intergenic
1118646497 14:67846116-67846138 TACCAACAGCAGCTGCGTTATGG + Intronic
1119131873 14:72180321-72180343 TTCCAACAACAGCTGCTATCTGG - Intronic
1122552257 14:102556407-102556429 AGTCACCATCAGCTGCTCTAGGG + Intergenic
1127213586 15:56800932-56800954 AACCAACAGCATCTGTTATAGGG - Intronic
1130892149 15:88142309-88142331 ATACAGCAGCAGCTGCTGCAAGG + Intronic
1130954212 15:88615436-88615458 ATCCAGCAGCAGCTGGACTTTGG - Intergenic
1131323653 15:91421643-91421665 ATCCCTCAGCAGCAGCTGTATGG - Intergenic
1131540602 15:93272015-93272037 ATCAAACAGCAGCAGCGCAAGGG - Intergenic
1132184407 15:99791426-99791448 AAAGAACAGCAGCTGCTCTCTGG + Intergenic
1137514618 16:49132411-49132433 ATCCAACATCAGTTTCTCTGGGG - Intergenic
1139422497 16:66857163-66857185 TTGCAACAGCAGCAGCTATAGGG - Intronic
1142106293 16:88304716-88304738 ATCCAGGAGCAGATGCTCTTTGG - Intergenic
1142208098 16:88793509-88793531 TCCCAACAGCAGCTGGTCTGAGG + Intergenic
1144457387 17:15430288-15430310 ATCCTGCAGCAGCTGCTTCAGGG + Intergenic
1146841191 17:36155481-36155503 TTCCTACAGCAACTGCTGTAGGG - Intergenic
1146853429 17:36243112-36243134 TTCCTACAGCAACTGCTGTAGGG - Intronic
1146869339 17:36367004-36367026 TTCCTACAGCAACTGCTGTAGGG - Intronic
1146966905 17:37039216-37039238 AACCAACAGAAAATGCTCTATGG - Intronic
1147072213 17:37967628-37967650 TTCCTACAGCAACTGCTGTAGGG - Intergenic
1147083738 17:38047165-38047187 TTCCTACAGCAACTGCTGTAGGG - Intronic
1147099684 17:38171132-38171154 TTCCTACAGCAACTGCTGTAGGG - Intergenic
1148824903 17:50385459-50385481 CCCCAAAAGCAGCTGCTCTCAGG + Intronic
1151751668 17:76042232-76042254 TTGCAACATCAGCTGGTCTAAGG - Intronic
1152290247 17:79436251-79436273 CTCCATTGGCAGCTGCTCTAAGG + Intronic
1152395831 17:80032548-80032570 ATGCAACATCAGGTGCTCAAAGG + Intronic
1153253106 18:3142240-3142262 AAACAACAGCAACTGCTCAATGG - Intronic
1154337507 18:13477353-13477375 ATCCAGCAGCAGGTCCTCTGTGG + Intronic
1155152928 18:23136336-23136358 GCCCAACTGCAGCTGCTCGACGG + Exonic
1155847904 18:30731812-30731834 AGCAAACAGCAGCAGCCCTACGG + Intergenic
1160106869 18:75986630-75986652 ATCCACCAGCAGCTGCCCAACGG - Intergenic
1160281419 18:77494286-77494308 AGACAGCAGCAGCTCCTCTAGGG + Intergenic
1161633852 19:5374664-5374686 ATCCACCAGAGGCTGCTCTGTGG + Intergenic
1162152346 19:8655439-8655461 ATCCCACAGCACCTGCTCCCTGG + Intergenic
1163712050 19:18852715-18852737 CTCCCACAGCAGCTGCTCCCTGG + Intronic
1165291203 19:34887702-34887724 CTCCAACACCAGCTCCTCCAGGG - Intergenic
1165767567 19:38360783-38360805 ATACATCAGAAGCTGCTCCACGG - Exonic
1165948482 19:39459221-39459243 ACCCAGCAGCAGCTGCTCCCAGG + Exonic
1165982265 19:39734819-39734841 AACCTACAGCAGCTGCACTGGGG - Intronic
1166510863 19:43407918-43407940 ACCCAGAAGCAGCTCCTCTAGGG - Intronic
1167534319 19:50039888-50039910 AACGAACAGTACCTGCTCTAGGG + Intronic
927486831 2:23494392-23494414 TTCCACCAGCAGCTCCTCCACGG + Intronic
928259607 2:29755060-29755082 TTCCAACAGCAGCTTCTCTAAGG + Intronic
928385822 2:30867052-30867074 CACCAACAGTAGCTGCTATAGGG - Intergenic
931663409 2:64591311-64591333 GTCCAAAAGCAGCAGCACTAGGG - Intronic
931869662 2:66444742-66444764 ATTCCACAGCAGCTACTCGAGGG - Intronic
932991406 2:76792602-76792624 ATGCAAGAGAAGCTGCTTTATGG + Intronic
934107433 2:88708665-88708687 ATCCAAGAGAAGTTGCTCTTGGG + Intronic
936327620 2:111519303-111519325 CTCCACCAGCAGTTTCTCTAGGG + Intergenic
936661367 2:114547473-114547495 ATCAAAATGCAGCTGCTTTATGG - Intronic
937112433 2:119377057-119377079 ACCCAACAGCAGCTGGTTTGTGG + Intergenic
939619072 2:144395655-144395677 ATCCAAGATCTGCAGCTCTATGG - Intronic
940757469 2:157699516-157699538 ATGCAATAGCAGCTGCACTTAGG - Intergenic
943514149 2:188863150-188863172 AGCAAACTGCAGCAGCTCTATGG + Intergenic
947352029 2:229256212-229256234 ATGGAACAGCAGCTGCTCAGTGG + Intronic
948924814 2:241088695-241088717 CTCCCACTGCAGCTGATCTAGGG - Exonic
1169085019 20:2821122-2821144 GTCAGACAGCAGCTGCTCTGAGG + Intergenic
1169987529 20:11461719-11461741 ATCCAACAAAAGCTCCTCTCTGG - Intergenic
1171091612 20:22290724-22290746 CTCCCACAGCATCTGCTCCAGGG - Intergenic
1171248979 20:23634494-23634516 ACCCAACACCAGCTTCTCCAAGG - Intronic
1173496793 20:43525288-43525310 ATCCAAGAGCATCTGGTCTAAGG + Intronic
1173503849 20:43571944-43571966 ATCCCACAGCTGCTGCCCTGGGG + Intronic
1174373798 20:50112493-50112515 CCCCAAAAGCAGCTGCTCCAAGG + Intronic
1175341387 20:58232692-58232714 TTCCAACAGCATCTGCCTTAGGG + Intergenic
1178488852 21:33035268-33035290 ACCCAGCAGCAGCTGCACTCTGG - Intergenic
1179520672 21:41942414-41942436 ATCCATCACCAGCTGCTCCTTGG - Intronic
1180301207 22:11037858-11037880 ATCCACCAGAAGCTCCACTATGG + Intergenic
1185149551 22:49156224-49156246 ATCCAACAGCAGCTCCACCAGGG + Intergenic
1185319456 22:50193809-50193831 ACCCAACAGCAGCTGCTCCTGGG + Intronic
949615937 3:5753839-5753861 AAGCAGCAGCAGCAGCTCTAAGG - Intergenic
958785343 3:98592218-98592240 ATACAACAGCAGCTTCTCACCGG - Intronic
962067861 3:132001921-132001943 ACTCAACAGCAGCTGATCTAGGG - Intronic
962318149 3:134371366-134371388 ATCCAGGAGCAGCTGCGCTACGG - Exonic
963348313 3:144123045-144123067 ATCCTACTGAAGCTGCTATAAGG - Intergenic
964152306 3:153541936-153541958 AACCAACAGCAGCAGCACTTGGG + Intergenic
964442199 3:156723516-156723538 CTCCAAATGCAGCTGCTCTCTGG + Intergenic
964675375 3:159272900-159272922 TTCCCACAGCAGCTTCTCCAGGG + Intronic
969219797 4:5752212-5752234 TTCCACAAGCAGCTGCTCTCAGG + Intronic
971330446 4:25677201-25677223 AACCAAGAGCAGCAGCTCCATGG + Exonic
973777809 4:54259197-54259219 ATCCCACCTCAGCTGCTCAAGGG - Intronic
973928343 4:55763116-55763138 ATCTAACAGCAGCTACTCTAAGG - Intergenic
974130418 4:57747980-57748002 AGCAAACTGCAGCAGCTCTATGG - Intergenic
977839383 4:101683206-101683228 ACCCAGCAGCAGCTGCCATATGG - Intronic
981138261 4:141237556-141237578 ATATAATAGCATCTGCTCTATGG - Intergenic
981187887 4:141826356-141826378 ATCAAACAGCAGTTATTCTATGG - Intergenic
985382760 4:189412770-189412792 CTCCAACTGCTCCTGCTCTAGGG + Intergenic
988384068 5:30539110-30539132 ATCCCCCAGCAGCAGCTGTATGG + Intergenic
993837553 5:92834592-92834614 AGCAAACAGCAGCAGCCCTAGGG - Intergenic
994349191 5:98725094-98725116 ATCCCACAGCAAATGCTCAATGG + Intergenic
999142648 5:149372596-149372618 ATCCCAAATCAGCTGTTCTAGGG - Intronic
1001013537 5:168119858-168119880 ATCCAACAGGATCTTTTCTATGG - Intronic
1004160189 6:13205997-13206019 ATCCAGCACCAGCTGCAGTACGG + Exonic
1006041720 6:31261573-31261595 ATCCAACAGATGCTTTTCTAGGG - Intergenic
1006090463 6:31625759-31625781 GTCCAACAGTAGCTGCTCAGAGG - Intronic
1006258218 6:32847964-32847986 ATCCAACAGCAGCTGTCCCCCGG + Exonic
1007493742 6:42244658-42244680 ATGAAAAAGCAGCTGCTTTATGG - Intronic
1008211051 6:48726521-48726543 ATCCTACAGCAGATGCTTAAGGG - Intergenic
1008385307 6:50882554-50882576 ATCCTACAGAAGAGGCTCTAAGG - Intergenic
1011683276 6:89803495-89803517 ATCCAAAAGCAACTGTGCTAAGG + Exonic
1015818147 6:137231258-137231280 CTGCAACATCAGCTGCTCTCTGG - Intergenic
1017066885 6:150537351-150537373 ATCCCACTGCTCCTGCTCTAGGG - Intergenic
1018733931 6:166673353-166673375 TTCCAACTGCAGCTGCCATAAGG + Intronic
1020011045 7:4805894-4805916 TTCCAAGGGCAGCTGCTCCAGGG + Intronic
1020268668 7:6578631-6578653 TTCAAACAGCAGCTCCTCTTGGG - Exonic
1022170026 7:27817705-27817727 ATCCAAAAAGAGCTGCTGTAAGG - Intronic
1022316953 7:29254529-29254551 AGACAACAGAAGCCGCTCTAAGG + Intronic
1024224052 7:47312178-47312200 ACACAACTGCATCTGCTCTATGG - Intronic
1027653542 7:80900927-80900949 ATCCAACATCTTCTGTTCTAAGG - Intronic
1027995690 7:85423485-85423507 ATGCAACTGCAGCTGCACCAGGG - Intergenic
1029105218 7:98169464-98169486 AACCAACAGCAGCTGCTGGCAGG - Intronic
1030347639 7:108452824-108452846 TTCCAATAGCTGCTGATCTATGG + Intronic
1030762198 7:113365605-113365627 GTCCAGCTGGAGCTGCTCTAAGG - Intergenic
1033100683 7:138468708-138468730 ATCCCTTAGCAGCTGCTCTCTGG + Intronic
1033151785 7:138920997-138921019 ATAAAACAGGAGCTGCTCAAGGG + Intronic
1033897396 7:146090817-146090839 ATCCTAAAACAGCTGCTCTTTGG - Intergenic
1034008671 7:147504236-147504258 CTCCCACAGCAGCTGCTCTCAGG - Intronic
1035037853 7:155907033-155907055 ATCCCACAGCCTGTGCTCTATGG - Intergenic
1036197228 8:6730147-6730169 ATCCAACAGCAGCATGTGTATGG - Intronic
1037092455 8:14939013-14939035 AACAAACAGCAGCTACTCCATGG + Intronic
1039771684 8:40694174-40694196 ACCCAGCAGCAGCTTCTCCAGGG - Intronic
1042635125 8:70866249-70866271 TTCCAACAGCAGCTTCACTGTGG - Intergenic
1044018265 8:87073557-87073579 AGCAAACAGCAGCAGCCCTATGG - Intronic
1049407803 8:142459416-142459438 ATACCACAGCAGCTGCCCCAGGG + Intronic
1049631995 8:143663857-143663879 ATCTAACAGCAGCTGTTGCATGG + Intergenic
1049646413 8:143737848-143737870 CTCCAGCAGCAGCTGCTCCTGGG + Intergenic
1050787070 9:9416814-9416836 AACCAACAGAAGCTGGTTTATGG - Intronic
1052823357 9:33156983-33157005 ATTCAACAGGAACTGCTCTGAGG + Intronic
1055286881 9:74738465-74738487 AGCCAACATCAGCTCCTCCAGGG + Exonic
1055296324 9:74837394-74837416 ATTCAACCACAGCTCCTCTATGG - Intronic
1059746111 9:117203613-117203635 AGCAAACTGCAGCAGCTCTACGG - Intronic
1061654813 9:132081004-132081026 ATGCAACCCCAGCTCCTCTAAGG - Intergenic
1186533996 X:10328554-10328576 AGCCAACAGCAGCTCCACGAAGG + Intergenic
1186944219 X:14547215-14547237 ACCCCAGAGCAGCTGCACTATGG - Intronic
1192634150 X:72802447-72802469 GTACAACACCAGCTGCTCTGTGG + Intronic
1192647560 X:72918354-72918376 GTACAACACCAGCTGCTCTGTGG - Intronic
1192872568 X:75198820-75198842 ATCCCCCAGCAGCAGCTCTGTGG + Intergenic
1194605240 X:95971845-95971867 ATCCAAAAGCAACTTCACTAGGG - Intergenic
1194953300 X:100152548-100152570 AGCAAACTGCAGCAGCTCTACGG - Intergenic
1196310715 X:114162160-114162182 AGGCAGCAGCAGCTGCACTATGG + Intergenic
1197481095 X:126986781-126986803 TTGCAACAGAAGCTACTCTAGGG + Intergenic
1200001992 X:153066885-153066907 GTACTACAGCAGGTGCTCTACGG + Intergenic
1200005740 X:153083140-153083162 GTACTACAGCAGGTGCTCTACGG - Intergenic