ID: 1080009694

View in Genome Browser
Species Human (GRCh38)
Location 11:27445550-27445572
Sequence CTGTATTCGTTGGGGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 174}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080009694_1080009701 3 Left 1080009694 11:27445550-27445572 CCCTCCTCCCCCAACGAATACAG 0: 1
1: 0
2: 0
3: 9
4: 174
Right 1080009701 11:27445576-27445598 CACACTTAGAAGTACAATAGAGG 0: 1
1: 0
2: 0
3: 8
4: 117
1080009694_1080009702 7 Left 1080009694 11:27445550-27445572 CCCTCCTCCCCCAACGAATACAG 0: 1
1: 0
2: 0
3: 9
4: 174
Right 1080009702 11:27445580-27445602 CTTAGAAGTACAATAGAGGCTGG 0: 1
1: 0
2: 1
3: 20
4: 155
1080009694_1080009703 16 Left 1080009694 11:27445550-27445572 CCCTCCTCCCCCAACGAATACAG 0: 1
1: 0
2: 0
3: 9
4: 174
Right 1080009703 11:27445589-27445611 ACAATAGAGGCTGGTTTCAGTGG 0: 1
1: 0
2: 6
3: 33
4: 675

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080009694 Original CRISPR CTGTATTCGTTGGGGGAGGA GGG (reversed) Intronic
900857454 1:5197404-5197426 GTGTATTTGGTGGGGGAGGGGGG + Intergenic
901426219 1:9183432-9183454 CTATAATGGTTGGGGCAGGAGGG - Intergenic
904900533 1:33853749-33853771 CTGGCTTCTTTGGGGGAGGCAGG + Intronic
907681875 1:56571973-56571995 CTGTATTTGCTGAGGAAGGAAGG - Intronic
909995107 1:82269499-82269521 CTCCATTCGTAGGGGGAGGGTGG + Intergenic
910172676 1:84394592-84394614 ATGTACTTGTTGTGGGAGGATGG - Intergenic
911645354 1:100332334-100332356 CAGTATTCATTGTGGGAGGGAGG + Intergenic
913324413 1:117614223-117614245 TTGAATTCCTTGGGGGATGAAGG - Intronic
915451652 1:156009502-156009524 CTGGATTTCTTGGGAGAGGAGGG + Exonic
916695516 1:167231993-167232015 GTGTGTGTGTTGGGGGAGGAGGG - Intronic
917081560 1:171261298-171261320 CTGTGTGTGTTGGGGAAGGAGGG - Intronic
918187754 1:182142989-182143011 CTGAATTCCTAAGGGGAGGAAGG + Intergenic
919763775 1:201114019-201114041 CTGTAAGCCTTGGGGGAGGGGGG - Exonic
920749717 1:208662274-208662296 GTGTGTTTGTTGGGGGAGGGGGG - Intergenic
924662541 1:246034954-246034976 CTGCATATATTGGGGGAGGAAGG - Intronic
1067745142 10:48929869-48929891 CTTTATTAATTGGGGGTGGATGG - Intronic
1068419985 10:56779033-56779055 CTGAAATCATGGGGGGAGGAGGG - Intergenic
1071052352 10:81466525-81466547 GTATATTAGTTGGGGGAGGGTGG - Intergenic
1071087345 10:81877986-81878008 TTGTATGCGTTGGGAGAGGAGGG + Intronic
1071415153 10:85434139-85434161 CTGTGTGGGTTGTGGGAGGATGG - Intergenic
1071862672 10:89690300-89690322 CCATATTAGTTGGGAGAGGAGGG + Intergenic
1072938015 10:99732101-99732123 CTCTTTTCCTTGGCGGAGGAGGG - Intronic
1073124673 10:101141911-101141933 CTGTAGGGGCTGGGGGAGGAGGG - Intergenic
1073208397 10:101780568-101780590 CTGTGTTGGTTGTGGGGGGAGGG - Intergenic
1073704745 10:105970477-105970499 GTGTAGTCGTTGTGGGAGCATGG - Intergenic
1075406973 10:122201503-122201525 CTGTGTTCATATGGGGAGGACGG + Intronic
1078522824 11:12077030-12077052 CTGTGTTCTTTTGAGGAGGAGGG + Intergenic
1080009694 11:27445550-27445572 CTGTATTCGTTGGGGGAGGAGGG - Intronic
1080197543 11:29630034-29630056 TTTTTTTGGTTGGGGGAGGAGGG + Intergenic
1082716074 11:56615556-56615578 CTGTATTTGTTGGAGGACAAAGG + Intergenic
1084953584 11:72679773-72679795 CTGTCTCAGTTGGAGGAGGAAGG - Intergenic
1085415486 11:76316678-76316700 CTGTGTTCGTTGTGGGATGTGGG + Intergenic
1085431543 11:76454918-76454940 CAGTATTAGGAGGGGGAGGAGGG - Intronic
1089065451 11:115659190-115659212 CTGTGCTCGGTGGGGGAGCAGGG - Intergenic
1091804378 12:3345605-3345627 CTGGTTTTGTTGGGGGAGGGGGG - Intergenic
1092056454 12:5511988-5512010 CTGTGTGCATGGGGGGAGGAGGG + Intronic
1092993310 12:13924393-13924415 CTTTCTTCTTTGGGGGAGCAGGG - Intronic
1095577599 12:43758400-43758422 AGGAATTCGTTGGCGGAGGAGGG + Exonic
1096682697 12:53267460-53267482 CTGAATTCTTTGGTGGAGGAAGG + Intergenic
1097056585 12:56253668-56253690 ATGAGTTCCTTGGGGGAGGAGGG + Intronic
1097910988 12:64969000-64969022 GTGTCTGCTTTGGGGGAGGATGG + Intergenic
1104983560 12:132584567-132584589 CTCTGCTGGTTGGGGGAGGAAGG + Exonic
1105850429 13:24329400-24329422 CTGTTTTCGTGGGGAGAAGAGGG + Intergenic
1106713550 13:32364514-32364536 CTGTATTAGTAGAGGGAAGATGG - Intronic
1109894062 13:68659046-68659068 GTGTATTTGTTGGGGGAAGAAGG - Intergenic
1117460404 14:55939443-55939465 CTGTCTGTGTCGGGGGAGGAGGG + Intergenic
1119655213 14:76412591-76412613 CCTTCTTTGTTGGGGGAGGATGG - Intronic
1119871975 14:78025829-78025851 GTGTGTGTGTTGGGGGAGGAGGG + Intergenic
1120602520 14:86529179-86529201 CTGGAATGGTTGGGGGAGGTGGG + Intergenic
1122079430 14:99256797-99256819 CTGTGCCCGTTGGGGGAGGTTGG - Intronic
1125441511 15:39708584-39708606 GTGTGTTGGTTGGGGTAGGAGGG - Intronic
1125908502 15:43415407-43415429 CTGTAGGGGATGGGGGAGGAGGG + Intronic
1126536493 15:49771317-49771339 CTGAATTCTCTGGGGGATGATGG + Intergenic
1126981049 15:54243250-54243272 CTGTATTAGTTTGCTGAGGATGG + Intronic
1129591275 15:76916932-76916954 TTGTATTTGTTGGGGGGGGGGGG + Intergenic
1130453640 15:84081684-84081706 TTTTTTTTGTTGGGGGAGGACGG + Intergenic
1131298393 15:91172616-91172638 TTCTATGTGTTGGGGGAGGACGG - Intronic
1131349152 15:91681056-91681078 CAGCATTCGTTGGGGGATAAGGG - Intergenic
1132406528 15:101544628-101544650 CTGTTTTTGGTGGGGAAGGAGGG - Intergenic
1138897142 16:61220513-61220535 CTGTACATGTTGGGGGAGGAGGG + Intergenic
1139301386 16:65948166-65948188 TAGGATTTGTTGGGGGAGGAGGG - Intergenic
1139963199 16:70729661-70729683 CTGTAATGGTTGGGGAAAGAAGG - Intronic
1140510990 16:75508457-75508479 CTTTTTTCATTGGTGGAGGAAGG - Intergenic
1144247950 17:13386061-13386083 CTGTATTTTTGGGGGGTGGATGG + Intergenic
1146454576 17:32998923-32998945 CTGAATTAGGTGGAGGAGGATGG - Intergenic
1147308505 17:39579774-39579796 CTGCATGCGGCGGGGGAGGAGGG - Intergenic
1147510105 17:41060713-41060735 CTGTACTATTTGGGGGTGGAGGG + Intergenic
1148498547 17:48070992-48071014 GTGTATTATTTGGGGGAGGGAGG - Exonic
1150414525 17:64976044-64976066 CTTTATTTGTTGGGGGCGGCGGG + Intergenic
1151009971 17:70483320-70483342 CTGGGGTGGTTGGGGGAGGAGGG + Intergenic
1153696379 18:7646902-7646924 CTGTATTTTTAGGGGGAGGTGGG + Intronic
1156585444 18:38426347-38426369 CTGCATGTGTTGGGGGAAGATGG + Intergenic
1158531839 18:58269609-58269631 ATGTATTGCTTGGGAGAGGAGGG + Intronic
1159387186 18:67741880-67741902 CTGTCTTGGCTGGGGGAGGGAGG - Intergenic
1164647887 19:29872828-29872850 TTGGATTCGTTGGGGGGGGGGGG + Intergenic
1164883905 19:31760693-31760715 GTGTATTCCTTGGGGTAGGGGGG + Intergenic
1166043245 19:40215398-40215420 CTCTATTTATTGGGGAAGGAGGG + Exonic
1168545612 19:57247386-57247408 CTGTATTTCTTGGGAGAGTAGGG + Intronic
924969781 2:115326-115348 CTGTCTTCTTTGGGGTGGGAAGG - Intergenic
925617428 2:5757107-5757129 CTCTATCCTTTGGAGGAGGAAGG - Intergenic
927797414 2:26062361-26062383 TTGTGTTTGTTTGGGGAGGAGGG - Intronic
929562138 2:42962530-42962552 CTGGAGGGGTTGGGGGAGGAGGG + Intergenic
930457748 2:51628219-51628241 CTTTTTTTGTTGGGGGAGGTGGG + Intergenic
931167978 2:59770481-59770503 CTGTATTCGTCGGGATAGGCTGG - Intergenic
932364168 2:71136710-71136732 CTTTATTTGTTGGGGAAGGGCGG - Intronic
933422957 2:82075362-82075384 CTAAATGCGTTGGGGGAGGGGGG - Intergenic
933534237 2:83552265-83552287 CTGTGTTAGTTTGAGGAGGATGG + Intergenic
933680378 2:85094717-85094739 CTGTATTGTGTGGAGGAGGATGG + Intergenic
933685810 2:85140400-85140422 CAGAAGTCGTTGGAGGAGGATGG + Intronic
937470719 2:122171863-122171885 CTGATTTCAGTGGGGGAGGACGG + Intergenic
938392732 2:130917636-130917658 CTGTGTTCACTGGGGGAGGGGGG - Intronic
940220183 2:151343490-151343512 CTGTTTTGGTTTGGGGAGGTGGG - Intergenic
942655176 2:178207716-178207738 CTGTGTTTGTCTGGGGAGGAGGG + Intronic
947650143 2:231780458-231780480 CTGGAGTAGTTGGGGGAGGTGGG - Intronic
948044229 2:234930693-234930715 CTTTATTGGATGGGGGAGAAGGG - Intergenic
1169698867 20:8424151-8424173 CTGTGTGTGGTGGGGGAGGAGGG - Intronic
1169787779 20:9378777-9378799 CTTAACTCGGTGGGGGAGGAGGG + Intronic
1169927594 20:10799135-10799157 CTGTGTGTGTTGGGGGAGGGGGG + Intergenic
1170398879 20:15958680-15958702 ATGAATTTGTTGGGGGTGGAGGG - Intronic
1170778504 20:19402310-19402332 CTGTAATCGTTAGGGGAAAAAGG - Intronic
1172803027 20:37591578-37591600 CTGTGTGGGTTTGGGGAGGAAGG - Intergenic
1174894356 20:54433173-54433195 TGGTAGTTGTTGGGGGAGGAGGG - Intergenic
1179732066 21:43373608-43373630 CGGAAGTGGTTGGGGGAGGAGGG + Intergenic
1182994325 22:34798856-34798878 CTGCAGTAGCTGGGGGAGGAGGG + Intergenic
1185026628 22:48417801-48417823 ATGTCTTCTTTGGGGGAGGCAGG - Intergenic
1185043703 22:48518384-48518406 CTGCCTTGGTTTGGGGAGGACGG - Intronic
949408525 3:3739699-3739721 GTGTGTGTGTTGGGGGAGGAAGG - Intronic
950355630 3:12406097-12406119 CTGTCTTCATTGGGGGAGGCGGG + Intronic
953529379 3:43726364-43726386 CTGTTTTCCATGGGGTAGGAGGG + Intronic
957535000 3:81490748-81490770 CTGTATTAGGTGGTGAAGGAAGG + Intronic
961518058 3:127450778-127450800 CTGTGGGAGTTGGGGGAGGATGG + Intergenic
978998419 4:115184793-115184815 CAGTTTTGGTAGGGGGAGGAGGG + Intergenic
979421089 4:120506198-120506220 CTGTCTTCTTTGTTGGAGGAGGG - Intergenic
981047335 4:140277304-140277326 CTGTATGAGTTGGGGGGGGCAGG + Intronic
981309748 4:143285642-143285664 CTGTATGGGGTGGGGGAAGAGGG - Intergenic
983774415 4:171588329-171588351 CTGTGTTCATTGGGAGAGAAAGG - Intergenic
984190160 4:176595813-176595835 CTGTATTATATGGGGAAGGAAGG + Intergenic
984391622 4:179141464-179141486 GTGTAATGGTTGGAGGAGGATGG - Intergenic
986825123 5:11512082-11512104 CTATATTGGTTGGGGAATGAGGG - Intronic
987995034 5:25265259-25265281 GTGTATGTGTTGGGGAAGGATGG - Intergenic
990330034 5:54716320-54716342 GTTTATTTGGTGGGGGAGGAGGG - Intergenic
990533207 5:56694361-56694383 CTGTTTTGGTCGGGGGAGGGAGG - Intergenic
992657110 5:78921894-78921916 CTGTGTTCTTGGGGGAAGGAAGG + Intronic
996209598 5:120790633-120790655 CTATATTGGTTGGAAGAGGAGGG + Intergenic
996421235 5:123265206-123265228 TTGCATTTGTTGGGGGAAGAGGG - Intergenic
996675668 5:126172100-126172122 CTGAATTCTTTGTGGGAGGGTGG + Intergenic
996784595 5:127224688-127224710 CTGAATGGGTTGGAGGAGGAAGG + Intergenic
1000346218 5:160316236-160316258 TTGTCTTGGTTGGGGGTGGATGG - Intronic
1002599930 5:180348295-180348317 CTGTGTGTGTTGGGGGAAGAGGG + Intronic
1002816617 6:686881-686903 ATTTATTTGTTGGGGGTGGATGG - Intronic
1002883167 6:1270870-1270892 CAGAATTCCTTGGGGAAGGATGG + Intergenic
1003707121 6:8545300-8545322 CTGTCTTCATTGTGTGAGGATGG + Intergenic
1006920099 6:37622133-37622155 AGGTATTGGTTGGGGGAGGAGGG - Intergenic
1007053036 6:38852379-38852401 CTGTATCTGTCGGGGGAGGAGGG + Intronic
1008498660 6:52157736-52157758 CTGTGTTCTTTGGGGGAAGTAGG - Intergenic
1010119332 6:72355814-72355836 TTGTTATTGTTGGGGGAGGAAGG - Intronic
1011031413 6:82927877-82927899 CAGTAGTTGTGGGGGGAGGAAGG + Intronic
1016472333 6:144387894-144387916 CTGTCTGCTTTGGTGGAGGATGG - Intronic
1018457235 6:163963185-163963207 CTGTATTAATTGGGGGGGGGGGG + Intergenic
1019886694 7:3911727-3911749 CTGTATTAGGTGTTGGAGGAGGG + Intronic
1020106788 7:5425909-5425931 CTGTGTGCCTTAGGGGAGGAGGG + Intergenic
1022184453 7:27953646-27953668 CTATATTCTTTGGGGGTGGAGGG + Intronic
1024287270 7:47769318-47769340 CTGTCTTGATTTGGGGAGGAAGG + Intronic
1028567438 7:92248170-92248192 CTCTTTTCCTTGGGGTAGGATGG + Intronic
1029036449 7:97527385-97527407 ATGAATTTGTTGGGGGAGGGAGG - Intergenic
1029663816 7:101981193-101981215 GTGTATAGGTTGGGGGAGGAGGG - Intronic
1031024451 7:116664839-116664861 CTGTATTTGCAAGGGGAGGAAGG - Intergenic
1031489120 7:122366065-122366087 GTGTTTTCTGTGGGGGAGGATGG + Intronic
1033348615 7:140544195-140544217 CTTTATTTGTGGGGGCAGGAGGG + Intronic
1033581332 7:142739833-142739855 GTGTACGTGTTGGGGGAGGAAGG + Intergenic
1033590968 7:142808098-142808120 CTCTGTTTGGTGGGGGAGGAGGG + Intergenic
1034499428 7:151440205-151440227 CTGGAGTGGTGGGGGGAGGAGGG + Intronic
1035331324 7:158098996-158099018 CGGGATGTGTTGGGGGAGGAAGG - Intronic
1036482829 8:9153279-9153301 TTTTTTTGGTTGGGGGAGGAGGG - Intronic
1038514410 8:28173060-28173082 CTGTATTCTTAAGGGGATGATGG + Intronic
1039159969 8:34606967-34606989 ATGACTTCCTTGGGGGAGGATGG + Intergenic
1040939156 8:52815251-52815273 CAGTATTCTTTGATGGAGGAGGG - Intergenic
1043464196 8:80487976-80487998 CTGTATGTGTTGTGGGGGGAAGG + Intronic
1050609934 9:7341514-7341536 ATATATTGGTTGGGGGGGGAGGG - Intergenic
1051036929 9:12758665-12758687 TTGTATTCTTTGGGGCAAGAGGG + Intergenic
1051679360 9:19591600-19591622 CTGTATTCTTGGAAGGAGGAAGG - Intronic
1052480861 9:29024022-29024044 GTGTATTGGTTGTGGGTGGAAGG - Intergenic
1052698593 9:31910358-31910380 TTGTATTTCTTGGGAGAGGAGGG + Intergenic
1053507826 9:38659814-38659836 CTGTGTCAGTTTGGGGAGGAAGG + Intergenic
1054703574 9:68438828-68438850 GTGTGTATGTTGGGGGAGGAGGG + Intronic
1056967955 9:91179893-91179915 CAGAATTATTTGGGGGAGGAGGG + Intergenic
1058730746 9:107847396-107847418 CTGAATAAGTTGGGGGAGGCTGG + Intergenic
1059880077 9:118678872-118678894 CTGTATTTTTTGGTGGAGAAGGG - Intergenic
1060236040 9:121863245-121863267 CTGGGTTCTGTGGGGGAGGATGG + Intronic
1060312604 9:122476142-122476164 CTGTATGTGTTTGGGGAGAAAGG + Intergenic
1186979579 X:14944819-14944841 CTTTATAGGTTGGGGGAGGGGGG + Intergenic
1188296179 X:28451948-28451970 CTGTCTTCTTTGGAGGAGTACGG + Intergenic
1188346209 X:29069019-29069041 CTGTATTCGCTGGGAGAGAGTGG - Intronic
1191628744 X:63298678-63298700 GTGTATTATTTGGGGGAGGGAGG - Intergenic
1193224741 X:78969162-78969184 TTGCATTCCTTGGGGGAGGGGGG - Intergenic
1194598698 X:95892565-95892587 ATGTGTGTGTTGGGGGAGGAAGG + Intergenic
1194966203 X:100291409-100291431 CGGTATTCACTGGGGTAGGAAGG + Intergenic
1195302465 X:103544221-103544243 TTGTTTTTGTTGGGGGATGAAGG - Intergenic
1196644605 X:118103728-118103750 CTGTGTGTGTTGGGGGAGGCAGG - Intronic
1197279498 X:124518393-124518415 GTGTGTTTGTTGGGGGCGGAGGG + Intronic
1198302706 X:135347031-135347053 CTGAAATCGTTGGGGTGGGAGGG - Exonic
1198696108 X:139340319-139340341 CTGTATTCATTGGATGAGGTTGG - Intergenic
1199886561 X:152026918-152026940 CTGAACTCGTGGGAGGAGGACGG - Intergenic
1201537847 Y:15070366-15070388 CTGTATTAGTTTGCTGAGGATGG - Intergenic