ID: 1080010421

View in Genome Browser
Species Human (GRCh38)
Location 11:27453419-27453441
Sequence GATAATTAGTCAATATCTAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 286
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 271}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080010421_1080010422 10 Left 1080010421 11:27453419-27453441 CCTATAGATATTGACTAATTATC 0: 1
1: 0
2: 0
3: 14
4: 271
Right 1080010422 11:27453452-27453474 AATTTCATTCCAGCCTTCCCTGG 0: 1
1: 0
2: 2
3: 29
4: 220

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080010421 Original CRISPR GATAATTAGTCAATATCTAT AGG (reversed) Intronic
901536798 1:9887817-9887839 AATAATTAATTAATTTCTATTGG - Intronic
902102035 1:13998436-13998458 GATAAAGAGTCAAGATCCATTGG + Intergenic
902719950 1:18297221-18297243 GATGATTTGTAAATATCTGTGGG + Intronic
906586997 1:46987088-46987110 GATAAAGAGTCAAGATCCATTGG + Intergenic
906978105 1:50597457-50597479 GATATTTATTCAAATTCTATGGG - Intronic
909998821 1:82316545-82316567 GATAATTATTCAACATGTACTGG - Intergenic
910619130 1:89234169-89234191 GATAAAGAGTCAATATCCATGGG - Intergenic
910926994 1:92407886-92407908 AATGATTAGTCAATATTTATTGG + Intergenic
910986123 1:93006828-93006850 GATCATTACCTAATATCTATGGG - Intergenic
911311398 1:96296391-96296413 GATAAATAATCAAGATCCATTGG - Intergenic
913026578 1:114849142-114849164 CATAACCAGTCAATATCTTTGGG + Intergenic
917740662 1:177959109-177959131 GGTAATGAGTCTATAGCTATAGG + Intronic
920898663 1:210084010-210084032 GATAATTTTTGAAAATCTATAGG + Intronic
922379796 1:225011880-225011902 GATAAAGAGTCAAGATCCATCGG - Intronic
924868309 1:248010881-248010903 GATAAAGAGTCAAGACCTATTGG - Intronic
1064862083 10:19837533-19837555 GATAATTTTACAATATTTATGGG + Intronic
1066258730 10:33707680-33707702 GACAATTAGTCAATTTTCATAGG - Intergenic
1069183560 10:65393571-65393593 GATATTTAGGCAATATCACTTGG + Intergenic
1071317232 10:84414076-84414098 AATAATTAGCCAAGATCCATCGG - Intronic
1072374664 10:94802513-94802535 GATAAAAAGTCAAGACCTATTGG - Intronic
1072493481 10:95932309-95932331 GATAATGAGTCAAGACCCATTGG - Intronic
1073598174 10:104820390-104820412 GTTAATAAGTAAATATTTATAGG - Intronic
1073713767 10:106077757-106077779 AATAATTAGCCAATTTCTAAAGG + Intergenic
1074315516 10:112357823-112357845 GATAAGTAGAGAATAGCTATTGG - Intergenic
1075536667 10:123277352-123277374 GATTTTTTGTTAATATCTATTGG + Intergenic
1078965504 11:16335871-16335893 GATATTTAATAAATAACTATTGG - Intronic
1079800572 11:24862597-24862619 GATAAAGAGTCAAGATCCATCGG + Intronic
1079896716 11:26128394-26128416 GATAAGTATTCAAAATCTAGTGG - Intergenic
1079960337 11:26915730-26915752 GATAATTAGTCAAGGTCTTTTGG - Intergenic
1080010421 11:27453419-27453441 GATAATTAGTCAATATCTATAGG - Intronic
1081339930 11:41915996-41916018 GATAATGAGTCAAGACCCATTGG - Intergenic
1083347374 11:62003036-62003058 GATGTTCAGTCATTATCTATTGG + Intergenic
1083368575 11:62159006-62159028 GATAAAGAGTCAAGATCCATCGG + Intergenic
1083772463 11:64875965-64875987 GAAAGTGAGTTAATATCTATAGG + Intronic
1085884648 11:80507315-80507337 GATAAAGAGTCAAGATCCATTGG + Intergenic
1085909102 11:80800011-80800033 GATAAAGAGTCAAGATCCATCGG + Intergenic
1085912392 11:80843391-80843413 GTTAACTAGTCAATTTCTAAGGG - Intergenic
1086132593 11:83416913-83416935 GATAAAGAGTCAAGATCCATTGG - Intergenic
1086522537 11:87686981-87687003 GATAAAGAGTCAAAATCCATTGG + Intergenic
1086553655 11:88084034-88084056 TATTCTTATTCAATATCTATTGG - Intergenic
1088532930 11:110830195-110830217 GATAAATAGCTAATATATATGGG + Intergenic
1089577451 11:119455863-119455885 GATAATTAGCTAATGTGTATGGG - Intergenic
1092320950 12:7473787-7473809 GATAAAGAGTCAAGATCCATCGG + Intronic
1092520570 12:9268527-9268549 AATCCTTAGTCAATATTTATAGG - Intergenic
1093335823 12:17904001-17904023 GATAAAGAGTCAAGATCCATCGG - Intergenic
1094139820 12:27169801-27169823 GATAAAGAGTCAAGACCTATTGG - Intergenic
1094173491 12:27519228-27519250 AATATTTAATCAATGTCTATGGG + Intergenic
1095567025 12:43636544-43636566 GACAATTTGTCAAACTCTATAGG - Intergenic
1095918042 12:47499776-47499798 GATAAAGAGTCAAGATCCATTGG + Intergenic
1098301381 12:69057555-69057577 GATACTTAATAAATATTTATTGG - Intergenic
1098591394 12:72218012-72218034 AATAAGTAGTCTATATCAATAGG + Intronic
1098895502 12:76055802-76055824 GATAATGAGCCATTATCAATGGG + Intronic
1099344334 12:81479356-81479378 GATAAAGAGTCAAGACCTATCGG - Intronic
1099699343 12:86063586-86063608 GATAAAGAGTCAAGATCCATTGG + Intronic
1099826846 12:87786859-87786881 GATATATAGTCAATATGTTTAGG - Intergenic
1100141936 12:91629811-91629833 GAAAATTAGTGGATATTTATAGG - Intergenic
1100521959 12:95383712-95383734 AATAATTATTCAAAATATATTGG - Intergenic
1101080924 12:101183407-101183429 GATATTCAGGCAATATCTACAGG + Intronic
1101165225 12:102023085-102023107 GATAATTACTAAATAAATATTGG - Intronic
1101723707 12:107372807-107372829 AATAATAAGTCAATATCTCCAGG - Intronic
1107505865 13:41032511-41032533 GATAATTAATAAATATCGCTGGG - Intronic
1109541119 13:63780347-63780369 GATAAATAGTCAAGACCCATCGG - Intergenic
1109635318 13:65107838-65107860 GATAAAGAGTCAAGATCCATTGG - Intergenic
1111080932 13:83306450-83306472 GATAAAGAGTCAAGACCTATTGG - Intergenic
1112152154 13:96775394-96775416 GATAACGAGTCAAGATCCATCGG + Intronic
1113257392 13:108522029-108522051 GATAATTAATAACTATTTATTGG - Intergenic
1113259664 13:108547569-108547591 GATATTTAGTTAAAATTTATTGG + Intergenic
1113626181 13:111849012-111849034 GTGAAATAGTCAATATATATAGG - Intergenic
1116112985 14:40610602-40610624 GATAAAGAGTCAAGACCTATTGG - Intergenic
1116528714 14:45939262-45939284 TATAATTATTCCATATCTACTGG + Intergenic
1116771233 14:49129701-49129723 GATAAAGAGTCAATATCCATCGG - Intergenic
1117187242 14:53252685-53252707 GATAACTATTGAATAACTATTGG - Intergenic
1117456113 14:55898519-55898541 GGTAAATAGTCATGATCTATGGG - Intergenic
1117710946 14:58527918-58527940 GATAATGAGTCAAGACCCATCGG + Intronic
1118147874 14:63159611-63159633 CATAATTAGTAAATACCCATAGG + Intergenic
1118281937 14:64437509-64437531 GATACTCAGTCAATATCCACTGG - Intronic
1118419053 14:65579304-65579326 GATATTCTGTCATTATCTATAGG - Intronic
1120256292 14:82123663-82123685 AATAATTAGCTAATATTTATTGG + Intergenic
1120484647 14:85097475-85097497 TGTAACTAGTCAATATCAATTGG - Intergenic
1123429016 15:20198758-20198780 GATAAATAGTCAAGACCCATTGG - Intergenic
1124527028 15:30464796-30464818 CAAAATTAGCCAATATCTATAGG + Intergenic
1124771625 15:32542887-32542909 CAAAATTAGCCAATATCTATAGG - Intergenic
1124935702 15:34168150-34168172 GATAAAGAGTCAAGACCTATCGG + Intronic
1124948213 15:34290911-34290933 GATAAAGAGTCAAGACCTATCGG - Intronic
1126258140 15:46652533-46652555 GATAATAAAGCAGTATCTATTGG - Intergenic
1126442900 15:48711176-48711198 GCTAATTAGTCATTATCTTAGGG + Intergenic
1126779467 15:52126412-52126434 GAGAATTAGTAAATACCTCTAGG - Intronic
1129094976 15:73196961-73196983 TATAGTTTGTAAATATCTATTGG + Intronic
1137420533 16:48329568-48329590 GATCATAAGTACATATCTATAGG + Intronic
1140166173 16:72554359-72554381 GACAATTAGTCCTTAACTATAGG - Intergenic
1140845207 16:78880492-78880514 AATAATTAGTCAAGCACTATCGG + Intronic
1148967624 17:51449206-51449228 GATAAAGAGTCAAGATCCATTGG + Intergenic
1149244912 17:54694556-54694578 AGTAATTAGTCAATAACTACAGG - Intergenic
1149364445 17:55928137-55928159 TATAATTAGTAAATATTTAAAGG + Intergenic
1149958695 17:61082529-61082551 TATAGTTAGTCAATTTATATTGG - Intronic
1151057261 17:71048004-71048026 GAAAATTTGTCAAAATCAATTGG + Intergenic
1151173831 17:72270615-72270637 GATGATTAGTTCATATTTATTGG - Intergenic
1154471733 18:14709771-14709793 GAAAAATAGTCAATGTCTCTGGG + Intergenic
1155575387 18:27240243-27240265 AGTAATGAGTCAATAGCTATAGG + Intergenic
1155886936 18:31219400-31219422 GATATTTAGGCAATAACTAGAGG + Intergenic
1156529714 18:37803851-37803873 GATAAGGAGTCAAGACCTATCGG - Intergenic
1156564346 18:38167601-38167623 TATAATTAATCAATATGTTTGGG - Intergenic
1159581565 18:70238929-70238951 GATAAAGAGTCAAGACCTATTGG + Intergenic
925838820 2:7971345-7971367 GAAAATTAGACAATAGCTCTAGG - Intergenic
926468516 2:13222491-13222513 AATAATTAGTCATTTTCTCTTGG + Intergenic
927021100 2:19018500-19018522 GATAAAGAGTCAAGATCCATTGG - Intergenic
927583576 2:24278395-24278417 GATATTTAATAAATATTTATTGG + Intronic
929876459 2:45800786-45800808 GATAATTAGTGAAGATTTACGGG - Intronic
931184314 2:59934935-59934957 GAAAATTACTTAATCTCTATGGG + Intergenic
932120328 2:69093180-69093202 GACATTTAGTCAACATTTATTGG - Intronic
934232476 2:90197213-90197235 GATAAAGAGTCAAGACCTATTGG + Intergenic
935019773 2:99218705-99218727 GATAATTATTCAATACCGAGTGG - Intronic
935381812 2:102460142-102460164 GAAAATTTGTCAAAATCAATAGG - Intergenic
935534059 2:104272470-104272492 AATACTTAGTTAATATCTTTAGG - Intergenic
935604521 2:104957536-104957558 GATAAGGAGTCAAGACCTATCGG - Intergenic
936171742 2:110182856-110182878 GATAAAGAGTCAAGATCCATCGG + Intronic
936669876 2:114644722-114644744 GTTATTCAGTCAATATTTATTGG + Intronic
937745431 2:125406986-125407008 TATTAATAGTCATTATCTATGGG + Intergenic
939033493 2:137103595-137103617 GATAAAGAGTCAATACCCATCGG + Intronic
939221321 2:139305135-139305157 GACATTTAGTCTTTATCTATTGG - Intergenic
939375995 2:141368017-141368039 GATAAAAAGTCAATATTTAATGG - Intronic
939463616 2:142529273-142529295 AATAATTATTCCATATCTACAGG + Intergenic
939648498 2:144732113-144732135 GAAAATTAGAGAATATCTAAAGG + Intergenic
940087927 2:149882290-149882312 TATAATTATACTATATCTATTGG - Intergenic
942953461 2:181748474-181748496 GATAAAGAGTCAATACCGATTGG - Intergenic
943294679 2:186121767-186121789 GATAATGAGTTAATATCCAAAGG - Intergenic
943393651 2:187304438-187304460 TATATTTAGTCAATATGAATGGG + Intergenic
944142648 2:196474244-196474266 AATAAGTATTCAATATCTTTTGG + Intronic
944848969 2:203697794-203697816 GATAAAGAGTCAAGATCCATCGG + Intergenic
945161650 2:206898145-206898167 GATAATGAGTCAAGACCCATTGG - Intergenic
1170475371 20:16708990-16709012 GTTAATTAGTGAAGAACTATTGG + Intergenic
1170502042 20:16983981-16984003 GAAAATTTGTCAATAACTTTGGG + Intergenic
1172466462 20:35158716-35158738 AATAATCTGTCATTATCTATTGG + Intergenic
1174725308 20:52855322-52855344 GAAAATTAGTCAAAATCTCTGGG - Intergenic
1174972408 20:55290912-55290934 GATATTAAATCAATATCTACAGG - Intergenic
1176802755 21:13448142-13448164 GAAAAATAGTCAATGTCTCTGGG - Intergenic
1177280316 21:18973524-18973546 GATAAAGAGTCAAGATCCATTGG + Intergenic
1177313442 21:19426371-19426393 GATAAAGAGTCAAGATCCATTGG + Intergenic
1178316683 21:31572376-31572398 GAATATTAGTCAAAATCTTTTGG - Intergenic
1182891613 22:33823716-33823738 GAAAATTCCTCACTATCTATGGG - Intronic
951045226 3:18030226-18030248 GAGAATTATTCAATGTCAATGGG + Intronic
952572546 3:34734045-34734067 GATAAAAAGTCAAGATCCATTGG + Intergenic
952574766 3:34761027-34761049 GATAAAGAGTCAAGATCCATTGG + Intergenic
953054167 3:39374449-39374471 AATAATTAGTCATTACCTATAGG + Intergenic
953264503 3:41372852-41372874 GATAAAGAGTCAAGATCCATAGG + Intronic
954486428 3:50857024-50857046 GATAATTAATCACTATCAAAAGG - Intronic
956356501 3:68399017-68399039 GACAATTAATCAATATTTTTTGG + Intronic
957108383 3:75920960-75920982 GATAAAGAGTCAATATCCAGAGG - Intronic
957424173 3:80015882-80015904 GATAATTAATAAATATATACTGG - Intergenic
957861991 3:85965025-85965047 GATAAGTACTATATATCTATTGG - Intronic
959354465 3:105308230-105308252 GATAAAGAGTCAAGACCTATTGG - Intergenic
959836901 3:110929201-110929223 GATAGTAAGTCAAAAACTATAGG - Intergenic
962853312 3:139323918-139323940 GATGATTTGTCAATGTCTGTAGG - Intronic
963416052 3:144997184-144997206 GATAAAGAGTCAAGATCCATTGG - Intergenic
963693122 3:148530038-148530060 GATAATCAATAAATCTCTATTGG + Intergenic
964566878 3:158066319-158066341 GATAAACAGTCAAAATCCATTGG + Intergenic
966284402 3:178276909-178276931 GATAATTATCAATTATCTATTGG + Intergenic
967294490 3:187951912-187951934 GATAATTAGTCAGTAGAAATGGG - Intergenic
967638844 3:191836665-191836687 GATAAAGAGTCAAGACCTATTGG + Intergenic
970169272 4:13273481-13273503 GATAATTCATCAATATCAAGTGG + Intergenic
970224502 4:13843542-13843564 GATAATGAGTTAATATTAATTGG - Intergenic
970548731 4:17157089-17157111 GGTAATTATTTTATATCTATAGG - Intergenic
970642217 4:18079759-18079781 GATGTTTAGTGAATATCTAAAGG + Intergenic
970685457 4:18561596-18561618 GATAAAGAGTCAAGATATATCGG + Intergenic
971171568 4:24238946-24238968 CATCTTTAGTAAATATCTATAGG - Intergenic
971733938 4:30421190-30421212 AATAATTACTCAATAGGTATGGG + Intergenic
971856414 4:32050458-32050480 AATTATTTGTCATTATCTATAGG + Intergenic
972742756 4:41904542-41904564 GATAAAGAGTCAAGACCTATTGG - Intergenic
973283442 4:48387398-48387420 GATAATTAAGGAATATATATAGG + Intronic
974196570 4:58583547-58583569 GATAATGAGTCAAGAACCATTGG - Intergenic
974300013 4:60051317-60051339 GCTAAATAGTCAATATTTGTGGG - Intergenic
976218114 4:82733543-82733565 GATAATAAGGTAATATTTATTGG - Intronic
976961437 4:90980934-90980956 GATAATTAATCAAGGACTATGGG - Intronic
977668943 4:99673020-99673042 GATAATGAGCCAAGATCCATAGG + Intergenic
977671610 4:99701280-99701302 GATAAATAGTCAAGACCCATCGG + Intergenic
979159169 4:117437063-117437085 TATCATTAGACAAAATCTATTGG - Intergenic
979364455 4:119803826-119803848 GATAATCAGTTAATATATTTTGG + Intergenic
979703921 4:123698018-123698040 AATAATTAGTCATTAATTATTGG + Intergenic
981984010 4:150831356-150831378 GATATTCATTCAATATCTACTGG - Intronic
982159060 4:152549012-152549034 TATTATTAGTCAATAAATATTGG - Intergenic
983774695 4:171592968-171592990 GATAAAGAGTCAAGATCTATTGG - Intergenic
987524224 5:19027123-19027145 GATCAGTAGTAAATATTTATTGG + Intergenic
988133559 5:27138135-27138157 GACAATTTATCAATATCTAATGG - Intergenic
988737423 5:34036555-34036577 GATAATTAATAAAAATGTATTGG - Intronic
989406031 5:41061806-41061828 GATGATTAGTAAATATGTAATGG + Intronic
989699586 5:44246089-44246111 GAGAATTATGCAATATCCATTGG + Intergenic
990148121 5:52786461-52786483 ACGAATTAATCAATATCTATTGG + Intergenic
991150221 5:63359302-63359324 GATAAAGAGTCAAGACCTATTGG - Intergenic
991481453 5:67085454-67085476 GATGATTAGTAAATATTTGTTGG + Intronic
991667453 5:69013423-69013445 CATAATGAGTCAATGTCTATAGG - Intergenic
993587107 5:89745148-89745170 GATAAAGAGTCAAAATCCATTGG - Intergenic
993672931 5:90784155-90784177 GATAATTAATAAATATTGATTGG - Intronic
993800380 5:92326583-92326605 TATAATTAATTAATTTCTATTGG - Intergenic
994793244 5:104258977-104258999 GATAACTAGGCATGATCTATTGG - Intergenic
997170740 5:131717510-131717532 GATAATTAGAAAATATTTTTAGG - Intronic
997785411 5:136707061-136707083 TTAAATTATTCAATATCTATAGG + Intergenic
997815485 5:137013155-137013177 GAAAATTAGAAAACATCTATAGG - Intronic
1005526360 6:26654825-26654847 TATAATTATTAAATATCTAGTGG - Intronic
1006201441 6:32295699-32295721 CATAAGTAGTCAATAAATATTGG + Intronic
1007997489 6:46323871-46323893 GATAATGAGAAAATATTTATTGG - Intronic
1008410272 6:51170209-51170231 GATAATTAGTTATTATCCAGAGG + Intergenic
1009718038 6:67426383-67426405 GATAAAGAGTCAAGATCCATTGG - Intergenic
1010394743 6:75377825-75377847 ACTAATAAGTCAATATCTCTTGG - Intronic
1010477226 6:76302931-76302953 GATAAAGACTCAATATCCATTGG - Intergenic
1011080442 6:83484935-83484957 AATAATTATTTAATATCCATAGG + Intergenic
1012323045 6:97876350-97876372 GAGAGTTATACAATATCTATGGG + Intergenic
1013342168 6:109225583-109225605 GATAAATATTCAATAACTGTAGG + Intergenic
1013654433 6:112230798-112230820 GATGCTTAATCAATATGTATTGG + Intronic
1013684904 6:112568610-112568632 GTTAATTAATAAACATCTATAGG - Intergenic
1013821495 6:114158413-114158435 GATAAATACTCAGTAACTATTGG - Intronic
1014058274 6:117042013-117042035 GATAAAGAGTCAAGACCTATTGG - Intergenic
1015535472 6:134263076-134263098 GTAAAATAGTCACTATCTATTGG - Intronic
1015545000 6:134352632-134352654 TATAATCAGTCAATATTTTTGGG + Intergenic
1019203379 6:170338954-170338976 GATAACGAGTCAAGACCTATTGG - Intronic
1021110058 7:16683319-16683341 GATCATTAGCTAATAGCTATAGG + Intronic
1022348941 7:29548169-29548191 GAAAATTACTTAATATCTTTAGG - Intergenic
1022618973 7:31963155-31963177 GATAATTGGTCAATAAATATAGG - Intronic
1023146441 7:37155373-37155395 GATAAAGAGTCAAGACCTATTGG + Intronic
1023475682 7:40575367-40575389 GATAATTAGGAACTATCTTTCGG - Intronic
1024087615 7:45909360-45909382 GATTATTTGTACATATCTATGGG - Intergenic
1028285049 7:88986139-88986161 GATAATTAGTCATTCTGTCTTGG - Intronic
1029277560 7:99416260-99416282 GGTAATTAGTCAGTCTCTCTTGG + Exonic
1030770889 7:113473864-113473886 GATAAATAGTCAAGACCCATTGG - Intergenic
1032295685 7:130636652-130636674 GATAAGGAGTCAAGATCCATTGG - Intronic
1032882772 7:136107311-136107333 GATAATTAATCACTATCAAGTGG - Intergenic
1034365718 7:150544850-150544872 GATAAAGAGTCAAGATCCATTGG + Intergenic
1035878908 8:3222134-3222156 GCTAATAAGTCATAATCTATGGG + Intronic
1036132643 8:6130543-6130565 GATAATTGGTGATTATCTCTAGG + Intergenic
1038093159 8:24277314-24277336 CATTATTAGTCAAGAGCTATAGG - Intergenic
1038207704 8:25483052-25483074 GGTCATTGCTCAATATCTATGGG - Intronic
1038893184 8:31750873-31750895 TATAATTTGACAATATCTTTTGG + Intronic
1041418861 8:57644916-57644938 GATAAAGAGTCAAGATCCATTGG - Intergenic
1041757186 8:61327294-61327316 ACTAATATGTCAATATCTATAGG - Intronic
1042597316 8:70463983-70464005 GATAAAGAGTCAATACCCATCGG - Intergenic
1043128508 8:76431218-76431240 GATACTTAGTCAATGTTTATGGG - Intergenic
1043653406 8:82629536-82629558 TGTAATTAGTAAATAACTATAGG + Intergenic
1043748688 8:83908408-83908430 GATAAAGAGTCAAAATCCATTGG - Intergenic
1044116991 8:88348161-88348183 GATAAAGAGCCAATATCCATTGG - Intergenic
1045833213 8:106489531-106489553 GATACTAAGTAAATATTTATTGG + Intronic
1046059827 8:109125107-109125129 GTTAATTATTTATTATCTATTGG + Intergenic
1050146968 9:2579055-2579077 GATAATTAGTCCATATCTCCTGG - Intergenic
1050375991 9:4973648-4973670 AATAATTTCTTAATATCTATAGG - Intergenic
1050577623 9:7014553-7014575 GATAAGTGGTAAATATTTATTGG + Intronic
1050894506 9:10870408-10870430 GAAAATCAGACAATAGCTATTGG + Intergenic
1051045520 9:12868724-12868746 GATAAAGAGTCAAGACCTATCGG - Intergenic
1051239371 9:15036974-15036996 AATAAATAGCCAATATTTATGGG - Intergenic
1053337107 9:37285289-37285311 CATAATTACTCAATATGTCTTGG + Intronic
1053694959 9:40629499-40629521 TCAAATTAGTCAATTTCTATAGG + Intergenic
1054269882 9:63010616-63010638 TCAAATTAGTCAATTTCTATAGG - Intergenic
1054306203 9:63428724-63428746 TCAAATTAGTCAATTTCTATAGG + Intergenic
1054404945 9:64752715-64752737 TCAAATTAGTCAATTTCTATAGG + Intergenic
1054438570 9:65238203-65238225 TCAAATTAGTCAATTTCTATAGG + Intergenic
1054491834 9:65783743-65783765 TCAAATTAGTCAATTTCTATAGG - Intergenic
1055140961 9:72876585-72876607 GAGAATTAGTCAGGATCTTTTGG + Intergenic
1055719591 9:79156706-79156728 GATATTTAGTCAATTTGAATTGG - Intergenic
1056045393 9:82710262-82710284 TATAATCAGTTAATGTCTATTGG - Intergenic
1056376747 9:86021621-86021643 GATAAATAGTCAAAAATTATAGG - Intronic
1057804272 9:98209418-98209440 TAGAATTAGTAAATATCTCTTGG - Intronic
1059352824 9:113677619-113677641 AATAAATAATCAATATCTGTTGG - Intergenic
1060320886 9:122560258-122560280 GATAAAGAGTCAAGACCTATTGG - Intergenic
1202777404 9_KI270717v1_random:3110-3132 TCAAATTAGTCAATTTCTATAGG + Intergenic
1185801015 X:3011025-3011047 AATAATAAATCAATATTTATGGG - Intronic
1187329244 X:18320909-18320931 ATTAACGAGTCAATATCTATAGG - Intronic
1187784544 X:22868873-22868895 GATAAAGAGTCAAGACCTATAGG + Intergenic
1188745258 X:33833473-33833495 GATTAATAGCCAATATATATAGG - Intergenic
1189128012 X:38468413-38468435 GATTATTAGTTAGCATCTATTGG - Intronic
1190403026 X:50057812-50057834 GATAATTAATCAACATTTGTAGG - Intronic
1190584624 X:51926726-51926748 GATATTAAGTCAATTTCTGTAGG + Intergenic
1190972021 X:55358682-55358704 GATAAAAAGTCAAGATCCATTGG + Intergenic
1192000774 X:67148987-67149009 GATAAAGAGTCAAGACCTATTGG - Intergenic
1192628824 X:72758908-72758930 GATAAAGAGTCAAGATCCATTGG - Intergenic
1192652886 X:72961906-72961928 GATAAAGAGTCAAGATCCATTGG + Intergenic
1192819380 X:74627838-74627860 GATAAATAATCAATAAATATAGG - Intergenic
1192883412 X:75312058-75312080 GATAAAGAGTCAATACCCATTGG - Intergenic
1194057986 X:89161917-89161939 GAGAAAGAGTCAATATCCATCGG - Intergenic
1195844029 X:109207262-109207284 GATAAAAAGTCAAGATCAATTGG - Intergenic
1195988551 X:110659097-110659119 GATAATGAGTCAAGACCCATTGG + Intergenic
1196054691 X:111342086-111342108 GATAAAGAGTCAAGACCTATTGG + Intronic
1197232279 X:124017780-124017802 CATAATTAGTATATATTTATGGG - Intronic
1197284985 X:124584747-124584769 GATAAAGAGTCAAGATCCATCGG + Intronic
1197429603 X:126344079-126344101 GATTACTAGTAAATATCTTTAGG - Intergenic
1198072378 X:133161542-133161564 GATAAAGAGTCAAGACCTATCGG + Intergenic
1199079733 X:143563105-143563127 GATAAAGAGTCAAGACCTATTGG + Intergenic
1201450826 Y:14112096-14112118 GATAATTTGTCTATGTTTATGGG + Intergenic
1201979138 Y:19888890-19888912 GATAAATAGTCAAGATCCATAGG - Intergenic
1202068391 Y:20964252-20964274 GATAAAGTGTCAAGATCTATTGG + Intergenic