ID: 1080011230

View in Genome Browser
Species Human (GRCh38)
Location 11:27461741-27461763
Sequence CCATGTGGACATAAGGAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 3, 3: 13, 4: 182}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080011230_1080011239 29 Left 1080011230 11:27461741-27461763 CCCTGCTCCTTATGTCCACATGG 0: 1
1: 0
2: 3
3: 13
4: 182
Right 1080011239 11:27461793-27461815 GTGGGCTCTCATTGGCATGAAGG 0: 1
1: 0
2: 0
3: 10
4: 108
1080011230_1080011236 11 Left 1080011230 11:27461741-27461763 CCCTGCTCCTTATGTCCACATGG 0: 1
1: 0
2: 3
3: 13
4: 182
Right 1080011236 11:27461775-27461797 GTGATCCAAGAAACTACAGTGGG 0: 1
1: 0
2: 0
3: 7
4: 107
1080011230_1080011238 21 Left 1080011230 11:27461741-27461763 CCCTGCTCCTTATGTCCACATGG 0: 1
1: 0
2: 3
3: 13
4: 182
Right 1080011238 11:27461785-27461807 AAACTACAGTGGGCTCTCATTGG 0: 1
1: 0
2: 1
3: 11
4: 106
1080011230_1080011235 10 Left 1080011230 11:27461741-27461763 CCCTGCTCCTTATGTCCACATGG 0: 1
1: 0
2: 3
3: 13
4: 182
Right 1080011235 11:27461774-27461796 AGTGATCCAAGAAACTACAGTGG 0: 1
1: 0
2: 0
3: 12
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080011230 Original CRISPR CCATGTGGACATAAGGAGCA GGG (reversed) Intronic
901678262 1:10899130-10899152 TCATGTGGACAGAAGGAGAGCGG - Intergenic
901815068 1:11789165-11789187 CCCTGGGGACAAAAGGAGCTGGG + Exonic
902504684 1:16931438-16931460 TCAGTTGGACATAAAGAGCAGGG - Intronic
902974160 1:20076822-20076844 CCCTGTGGAAAGAAGGATCATGG + Intronic
907992931 1:59600391-59600413 CCATGTGGAGCTCAGGAGCAAGG + Intronic
908578153 1:65483740-65483762 CCATGTGGATATCTGGAGGATGG - Intronic
911656389 1:100448724-100448746 GAATGAGGCCATAAGGAGCATGG - Intronic
912208407 1:107533094-107533116 CCATGTGGATATAAGAGGCAAGG + Intergenic
913519172 1:119629845-119629867 CCATGTGGATACAAGAACCAGGG + Intronic
914854494 1:151341413-151341435 CCAAGTGGAAACTAGGAGCAGGG - Exonic
916056553 1:161072613-161072635 CCATGTCAACAGAAGGAGCCAGG + Exonic
919078039 1:192836308-192836330 CCATGTGGATTTAAGGATAAAGG - Intergenic
919706736 1:200683512-200683534 CCATATGTACATATGGAGAATGG - Intergenic
920201341 1:204261582-204261604 CCATGCGGAGCTCAGGAGCAAGG + Intronic
924351139 1:243115678-243115700 CCATGTGGACATCAGGCCAAGGG + Intergenic
924691036 1:246350697-246350719 CCAAGTGGAAATCAGGAGAAAGG + Intronic
1065811242 10:29445734-29445756 CCATTAGGACACAGGGAGCATGG - Intergenic
1065908811 10:30283546-30283568 CCATTAGGACACAGGGAGCATGG - Intergenic
1069949465 10:72009177-72009199 CCCTGTGGGCATAAGCAGCGAGG - Exonic
1070821239 10:79355933-79355955 CAAGGAGGACACAAGGAGCATGG + Intergenic
1071425881 10:85549728-85549750 CCATGTGGACTTAAAAAGAATGG - Intergenic
1072193895 10:93098300-93098322 TCTTGGGGACAAAAGGAGCAGGG - Intergenic
1073438340 10:103535931-103535953 CCATGTGGGCACAGGGGGCATGG + Intronic
1076059219 10:127400488-127400510 CTATGTGGCCATCAGGAGCAAGG + Intronic
1076150417 10:128157778-128157800 CCATGAGGCCTAAAGGAGCAGGG + Intergenic
1077347672 11:2071534-2071556 CCATGTGGTCATAAGCAGAGAGG - Intergenic
1077876810 11:6316004-6316026 TCGTGTGGTCATAAGGAGCAAGG + Intergenic
1078134958 11:8644138-8644160 TCCTGTGGACTGAAGGAGCAGGG - Intronic
1079139115 11:17795842-17795864 GCATGTGTACACAAGGGGCATGG + Intronic
1080011230 11:27461741-27461763 CCATGTGGACATAAGGAGCAGGG - Intronic
1080191255 11:29552043-29552065 ACATTTGGACATAGGGAGAAGGG + Intergenic
1081255337 11:40886059-40886081 CCAAGTTTACAGAAGGAGCAAGG - Intronic
1081674134 11:44958538-44958560 CCCAGGGGACAGAAGGAGCACGG - Intergenic
1081816659 11:45948117-45948139 CCATGTGGAGAAAAGGATCTTGG + Intronic
1085564084 11:77497185-77497207 CCATGGGGAGATAAGGACCTGGG - Intergenic
1088733720 11:112707793-112707815 CCATGTTGACCTCAGGAGCAGGG - Intergenic
1090420051 11:126568459-126568481 CCACGTTGACATAGAGAGCAGGG + Intronic
1090450681 11:126803348-126803370 CCGTGTGTACAAAAGCAGCAAGG + Intronic
1092659294 12:10722252-10722274 GCATGTGGCCAACAGGAGCATGG + Intronic
1094626785 12:32132031-32132053 CCAAGTGGTCAGAAGGAGCAAGG + Intronic
1095977599 12:47950264-47950286 CCAAGAGGACAGAGGGAGCAAGG + Intergenic
1096332919 12:50730143-50730165 CAATATGGACATACGGAGTAGGG - Intronic
1096633272 12:52943335-52943357 CCAGGTGCACAAAAGGATCAGGG - Intronic
1097960446 12:65527306-65527328 CCTTCTGGATATAAGCAGCACGG + Intergenic
1098798029 12:74918063-74918085 ACATGAGTACATAAGGAACATGG + Intergenic
1100791777 12:98138083-98138105 CCAAGTGCACAGAAGGAGGAAGG - Intergenic
1102052858 12:109875712-109875734 CCAATTGGAGATAAGGAGGAAGG + Intronic
1103955551 12:124574569-124574591 CTTGGTGGACATAAGGCGCATGG - Intergenic
1104628227 12:130377354-130377376 CCATGTGCACCCAAGGATCAAGG - Intergenic
1105825681 13:24120475-24120497 CCTTTTGCACATCAGGAGCATGG + Intronic
1107744304 13:43488789-43488811 TCAGATGGACATAAGGAACAGGG + Intronic
1111967880 13:94879416-94879438 CACTGTGAACATAAGCAGCAAGG - Intergenic
1114031799 14:18585500-18585522 CCAGGTGGACATCAGGTGCCAGG - Intergenic
1114032386 14:18588322-18588344 CCAGGTGGACATCAGGCGCCAGG + Intergenic
1114077167 14:19167348-19167370 CCAGGTGGACATCAGGCGCCAGG + Intergenic
1115367606 14:32576261-32576283 CCTGGAGGTCATAAGGAGCAAGG - Intronic
1118745325 14:68769029-68769051 CCAAGTTTACACAAGGAGCAGGG + Intergenic
1121195469 14:92067978-92068000 CCATGTGGAGATCAGTAACAAGG - Intronic
1121447876 14:93989629-93989651 CCAGGTGGGCATGAGGAACAAGG - Intergenic
1122227308 14:100287194-100287216 CCCTTTGGACATCAGGTGCATGG - Intergenic
1122834345 14:104423677-104423699 CCATGTGGAAATATGGAGACAGG + Intergenic
1202897146 14_GL000194v1_random:16753-16775 CCAGGTGGACATCAGGTGCCAGG + Intergenic
1123990936 15:25682766-25682788 CCATGTGGGCAAAAAGAACATGG - Intronic
1128643651 15:69359216-69359238 CAATGTGGTGACAAGGAGCAGGG - Intronic
1128958043 15:71970808-71970830 CCATGTGGCCATAAATATCAGGG - Intronic
1129169476 15:73798912-73798934 CCGTGTGGACATTAGGAGCATGG - Intergenic
1131728744 15:95256360-95256382 CCATGTGGAGAGCAGCAGCAAGG - Intergenic
1135272012 16:21077648-21077670 CCATGTGGAAACAAGAAGAAAGG - Intronic
1135492015 16:22917490-22917512 CCATGTGTCCATAGGAAGCAAGG + Intergenic
1135931518 16:26741917-26741939 CCTTGTGGGTATAAGGAGCTAGG - Intergenic
1136922286 16:34343347-34343369 ACATGGGGTCAGAAGGAGCATGG + Intergenic
1136982287 16:35068459-35068481 ACATGGGGTCAGAAGGAGCATGG - Intergenic
1137359123 16:47797202-47797224 CCACTTGGACTTAAGGAGCTAGG + Intergenic
1143173817 17:4945276-4945298 CCCTTTAGCCATAAGGAGCAAGG + Intergenic
1144802006 17:17935736-17935758 CCATTAGGACATAAGGAACGAGG + Intronic
1144834370 17:18149195-18149217 CCCTGTGGAGAAAAGGAACATGG - Exonic
1146634595 17:34494677-34494699 CCAGGTGACCAGAAGGAGCAGGG + Intergenic
1147118871 17:38323433-38323455 CCATCTGGAGCTAAGGAACAAGG - Intergenic
1149700540 17:58651472-58651494 CCAAGTGGAAATAAGGAGCAAGG + Intronic
1151804641 17:76397846-76397868 CCGTGTGGACGTCAGCAGCAAGG - Exonic
1152944210 17:83190343-83190365 CCAGGTGGACAGAAGGACAAAGG - Intergenic
1153943604 18:9997865-9997887 CCATGTGGACACAGGCACCAGGG + Intergenic
1155742601 18:29308109-29308131 CCCTGTGCACATAATAAGCAGGG + Intergenic
1157102341 18:44742414-44742436 CCATCTTGGCATAAGGACCAGGG - Intronic
1157473016 18:48004068-48004090 CCATGAGGCTATAAGGAGGACGG - Intergenic
1157523331 18:48360556-48360578 CCAGGAGGACAGAAGGAGCCAGG + Intronic
1157572396 18:48721619-48721641 CCTTGGGGACATAAGAAGAATGG - Intronic
1159970726 18:74648741-74648763 ACATGTGGACATAGGTAGCACGG - Intronic
1160353243 18:78203355-78203377 CCCTGTGGACAGAGTGAGCAGGG - Intergenic
1163518570 19:17779131-17779153 CCACGTGGACATGAGGGGAAAGG + Intronic
1163557197 19:17999541-17999563 CCATGGGGACGTCAGGAGGAGGG + Exonic
1166811544 19:45517519-45517541 CCACGTGGACAGAAGGAGACGGG - Intronic
1168186823 19:54705453-54705475 CCATGATGACATAGGGAGAACGG + Intergenic
933735522 2:85490878-85490900 CAATGTGGAAATAAGGTTCATGG - Intergenic
935383278 2:102475728-102475750 CCATATGGACATGAGGAGTGAGG + Intronic
935570346 2:104653745-104653767 ATATGTGGCCAGAAGGAGCAGGG - Intergenic
935841262 2:107113633-107113655 CCAAGTGGACACACGGAGCCAGG + Intergenic
935844417 2:107149302-107149324 ACATGAGGACACAAGAAGCATGG - Intergenic
937747241 2:125429311-125429333 CCTTGTGGAAATGAGGAGGAAGG - Intergenic
938491165 2:131762045-131762067 CCAGGTGGACATCAGGTGCCAGG - Intronic
940901165 2:159127867-159127889 CAATTTGGAAAAAAGGAGCATGG + Intronic
941351363 2:164441147-164441169 CCATTGGGACAAAAGGAACAAGG + Intergenic
944204744 2:197145602-197145624 CCATGTGACCATCAGGAGCGTGG + Intronic
944565716 2:200988976-200988998 CCATGTGGAATTAAGCAGCCTGG + Intronic
945100754 2:206260298-206260320 CCAGGTGGGCATATGGGGCAAGG + Intergenic
947006104 2:225513324-225513346 CCATGAAGACAAAAGGAGCCAGG - Intronic
947235662 2:227938210-227938232 CCATTTGGAAATAAGGAGGTTGG + Intergenic
947353084 2:229266859-229266881 CCAAATTGACAAAAGGAGCAAGG - Intronic
1169476079 20:5932455-5932477 CCATGTGGACACCTGGGGCAAGG + Intergenic
1169709116 20:8541427-8541449 CCATGTGCCCAGAAGGAGAATGG - Intronic
1172435461 20:34926030-34926052 CCATGGGTACAGATGGAGCATGG + Intronic
1173093560 20:40001324-40001346 CTATGTGGTCATAAACAGCAGGG - Intergenic
1174091312 20:48050543-48050565 CAATGTGGGCATTAGGGGCATGG + Intergenic
1175526891 20:59640567-59640589 CCATGTCATCATAATGAGCAGGG - Intronic
1176616831 21:9032742-9032764 CCAGGTGGACATCAGGTGCCAGG + Intergenic
1177289083 21:19086806-19086828 CCATAGGGACAAAAGGAGCAAGG - Intergenic
1179508457 21:41857100-41857122 CCATGTGGGAATGGGGAGCAAGG - Intronic
1180292973 22:10860977-10860999 CCAGGTGGACATCAGGCGCCAGG + Intergenic
1180455913 22:15512557-15512579 CCAGGTGGACATCAGGTGCCAGG - Intergenic
1180456497 22:15515379-15515401 CCAGGTGGACATCAGGCGCCAGG + Intergenic
1180495779 22:15890399-15890421 CCAGGTGGACATCAGGCGCCAGG + Intergenic
1180795952 22:18605495-18605517 GCATGGGGGCATGAGGAGCAGGG + Intergenic
1181225770 22:21389776-21389798 GCATGGGGGCATGAGGAGCAGGG - Intergenic
1181252864 22:21545037-21545059 GCATGGGGGCATGAGGAGCAGGG + Intergenic
1181635067 22:24170676-24170698 CCATGTGGAATTGAGGAACAGGG + Intronic
1182742435 22:32577809-32577831 TCATGTGGACATGTGGAGGAAGG - Intronic
1183920026 22:41158522-41158544 ACATGTGGACACATGGACCATGG - Intronic
1184203363 22:42984643-42984665 GCATCTGGGAATAAGGAGCAGGG + Intronic
1184643078 22:45882479-45882501 CCATGGGGGCCTAAGGAGAAGGG + Intergenic
1185189725 22:49427576-49427598 CCCTGGGGACATCAGGAGCATGG + Intronic
952182577 3:30933718-30933740 CCTAGTGGACAAAAGGATCAGGG - Intergenic
952227604 3:31394862-31394884 CCATGTGCACATAAAGATCAGGG + Intergenic
953187352 3:40651231-40651253 CCATCTGGACAGGAGGAGAAGGG + Intergenic
953709583 3:45258987-45259009 CCCTGTGGACATGAAGAGAAGGG - Intergenic
955080000 3:55649721-55649743 CCATGGGGAAATGAGGAGGAGGG - Intronic
959406274 3:105965539-105965561 CCATGCTCACATTAGGAGCATGG - Intergenic
961526103 3:127498661-127498683 CCATGTGGTAAGAAGGAGCAGGG - Intergenic
961771728 3:129254964-129254986 CTCTGTGGGCAAAAGGAGCAGGG - Exonic
962992241 3:140588827-140588849 CCAGGTAGAAATAAGGAGGAAGG - Intergenic
966304704 3:178518290-178518312 CCAAGTAGACATAAGGAAAAGGG + Intronic
969248786 4:5953844-5953866 CCAGGTGGACATAGGTGGCAAGG + Intronic
969491666 4:7502687-7502709 CCATGTGGACAGAAGCTGCAAGG + Intronic
975282057 4:72572183-72572205 CCATGTGGACAGGAAGAGGAAGG - Intergenic
975633796 4:76425854-76425876 CCATGGGGACAAAGGAAGCAGGG + Intergenic
975665773 4:76733431-76733453 GCATGGGGACAAAAGGAGAAAGG + Intronic
982307598 4:153949591-153949613 TCGTGTAGACATAAGGACCAAGG + Intergenic
983476515 4:168218725-168218747 CCATGTTGACATAGTGAGCTTGG + Intronic
984352039 4:178607876-178607898 CCATAGGCAGATAAGGAGCAAGG + Intergenic
985619241 5:945161-945183 TCATGGGAACACAAGGAGCACGG - Intergenic
987392187 5:17386851-17386873 CCGTGTGGACAAAACCAGCATGG + Intergenic
987501236 5:18711941-18711963 ACATGTGGACACAAAGAGAAGGG + Intergenic
987718185 5:21598249-21598271 TCATATGGCCAGAAGGAGCAAGG + Intergenic
990733246 5:58832179-58832201 CCATGTGGCCAATAGGTGCATGG + Intronic
993127027 5:83847816-83847838 CCATGTGGATATCTGGAGGAAGG - Intergenic
995291985 5:110467786-110467808 CCATGTGGACACATTGATCATGG - Intronic
996236651 5:121139081-121139103 CCATCTGTACATAATGTGCAAGG + Intergenic
1001820382 5:174705550-174705572 CCCTGTGGAGAGAAGCAGCAAGG + Intergenic
1004638827 6:17494452-17494474 CCATGTAGACATCTGGAGGAAGG - Intronic
1006861913 6:37177412-37177434 CCATGTGGCTATAAAGAGGAAGG + Intergenic
1007690305 6:43696718-43696740 GCATGTGGACACCAGGAGAAAGG - Intergenic
1014121644 6:117732512-117732534 CCATGTGGACTTAAACAGAATGG + Intergenic
1014282414 6:119456389-119456411 GCATGTGGAAATCAGGAGCCAGG + Intergenic
1016044816 6:139470287-139470309 CAATAAGGACATAAGCAGCATGG + Intergenic
1017775121 6:157674588-157674610 TCATATGGTTATAAGGAGCAAGG - Exonic
1018799432 6:167210707-167210729 CCAAGTGGGCAGAGGGAGCAGGG + Intergenic
1020285211 7:6673691-6673713 CCCTGTGATTATAAGGAGCATGG + Intergenic
1021595758 7:22314928-22314950 CCTTGAGTGCATAAGGAGCAGGG - Intronic
1023017977 7:35985002-35985024 CCATGTGGTCAAAATAAGCATGG - Intergenic
1024481997 7:49873325-49873347 CAAGGTGGACATAGGGAGAAGGG - Intronic
1027893370 7:84007415-84007437 CCCTGTGGGCATATGGACCAAGG + Exonic
1028385131 7:90245423-90245445 CCATGTGGACAGAGGAAGCCGGG + Exonic
1028491249 7:91414476-91414498 CCATCTGGACACAATGAGAACGG + Intergenic
1030007414 7:105132799-105132821 CCCTGCGGACATCTGGAGCACGG - Exonic
1030475320 7:110025440-110025462 TCATCTGGAAATAATGAGCATGG - Intergenic
1033602083 7:142895755-142895777 CCTTGTCTACAAAAGGAGCACGG + Intergenic
1034971058 7:155419297-155419319 CCATATGGACCCATGGAGCAGGG + Intergenic
1035763048 8:2084009-2084031 CCAAGGGGACAGAAGGAACAAGG - Intronic
1036629224 8:10498829-10498851 CCATTTGTACATGAGAAGCATGG + Intergenic
1037293059 8:17371602-17371624 CCATGTGGAATTAAGGAGCATGG - Intronic
1039351651 8:36770133-36770155 CCATGTGGCCAGAAAGAGGAAGG + Intergenic
1039487052 8:37918331-37918353 CCATGGGCACATACGAAGCAGGG - Intergenic
1043496790 8:80810141-80810163 CCCTGTGGGCATGAGGAGCTAGG - Intronic
1048638522 8:136326597-136326619 CCATGTGGTTGGAAGGAGCAGGG - Intergenic
1049064786 8:140304541-140304563 TCAGGTGGAGATGAGGAGCAAGG + Intronic
1050231870 9:3534849-3534871 ACACGTGGAGATAAGGAACAAGG + Intergenic
1050641628 9:7674332-7674354 AAATGTAGACATAAGGATCATGG - Intergenic
1051795573 9:20865569-20865591 CCATGTGGCCATACGGCACATGG - Intronic
1052432347 9:28382982-28383004 CAATGTGGACAAAAAGAACAAGG + Intronic
1052530529 9:29678139-29678161 CCATGGGGACAAAAGTAGAATGG + Intergenic
1057283215 9:93727367-93727389 GGATGTGGACATGAGGACCAGGG - Intergenic
1059249315 9:112874134-112874156 CCATGTGGAAATGAGGAGAGAGG + Exonic
1059434831 9:114269811-114269833 CCATGGGTACAAGAGGAGCATGG + Intronic
1060179024 9:121519137-121519159 CCACATGCACATTAGGAGCATGG - Intergenic
1062064209 9:134517615-134517637 CCACGTGGACAGAGGGATCATGG + Intergenic
1062439291 9:136562522-136562544 CCAGGTGGATATGAGGATCAAGG - Intergenic
1190823442 X:53995680-53995702 CCTGGTGGAAGTAAGGAGCATGG - Exonic
1195918982 X:109963752-109963774 CCATCTGAACAGAAGGAGCAGGG - Intergenic
1201150232 Y:11091593-11091615 CCAGGTGGACATCAGGTGCCAGG + Intergenic
1201303837 Y:12533976-12533998 CAATGTGGACAGAATGACCAAGG + Intergenic