ID: 1080013784

View in Genome Browser
Species Human (GRCh38)
Location 11:27483946-27483968
Sequence AGCAAATGTACTTGGTGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 1, 2: 3, 3: 10, 4: 138}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080013784_1080013790 18 Left 1080013784 11:27483946-27483968 CCAGCACACCAAGTACATTTGCT 0: 1
1: 1
2: 3
3: 10
4: 138
Right 1080013790 11:27483987-27484009 AGATGAAGAGATGAGCTACGGGG 0: 1
1: 1
2: 1
3: 10
4: 156
1080013784_1080013788 16 Left 1080013784 11:27483946-27483968 CCAGCACACCAAGTACATTTGCT 0: 1
1: 1
2: 3
3: 10
4: 138
Right 1080013788 11:27483985-27484007 CAAGATGAAGAGATGAGCTACGG 0: 1
1: 1
2: 3
3: 39
4: 373
1080013784_1080013791 24 Left 1080013784 11:27483946-27483968 CCAGCACACCAAGTACATTTGCT 0: 1
1: 1
2: 3
3: 10
4: 138
Right 1080013791 11:27483993-27484015 AGAGATGAGCTACGGGGATCTGG 0: 1
1: 1
2: 0
3: 10
4: 94
1080013784_1080013789 17 Left 1080013784 11:27483946-27483968 CCAGCACACCAAGTACATTTGCT 0: 1
1: 1
2: 3
3: 10
4: 138
Right 1080013789 11:27483986-27484008 AAGATGAAGAGATGAGCTACGGG 0: 1
1: 1
2: 2
3: 30
4: 280

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080013784 Original CRISPR AGCAAATGTACTTGGTGTGC TGG (reversed) Intergenic
901491478 1:9598492-9598514 AGCAGATGTACAAGCTGTGCCGG + Exonic
904069865 1:27786248-27786270 AGCAAGGGTACTTGATGTGATGG - Intronic
908179993 1:61593972-61593994 AGCAAATGTACAGGGTGTTATGG - Intergenic
911565576 1:99459716-99459738 AGCCATTGTAATAGGTGTGCAGG - Intergenic
917375141 1:174344013-174344035 AGCAGCTTTACTTGGTGTGGTGG + Intronic
920429622 1:205909289-205909311 AGTAAATGTAGAGGGTGTGCTGG + Intergenic
923237808 1:232051408-232051430 AGCAAAAGTACTGGGTGTCTAGG - Intergenic
1063913026 10:10851904-10851926 AGCCATTGTAATAGGTGTGCAGG - Intergenic
1067792656 10:49299617-49299639 GGCTAAGGTTCTTGGTGTGCTGG + Intronic
1068005611 10:51390033-51390055 AGCCAATGTGCTTGGTAAGCAGG + Intronic
1069964873 10:72106118-72106140 AGAAAATCTACTTCTTGTGCTGG + Intronic
1075984501 10:126772484-126772506 AGCAAATGTACCAGGTGTGGTGG - Intergenic
1078647930 11:13159405-13159427 AGCAAATGTAGTGGATGTGGTGG + Intergenic
1080013784 11:27483946-27483968 AGCAAATGTACTTGGTGTGCTGG - Intergenic
1083495405 11:63047701-63047723 AGCCCATGTACTTGCTATGCCGG - Intergenic
1084702416 11:70796088-70796110 AGAAAATGTACATCCTGTGCAGG - Intronic
1085817869 11:79760155-79760177 AGCAAGTGTTCTAGGTGAGCGGG + Intergenic
1086366710 11:86114313-86114335 TGCAAATGAGCATGGTGTGCAGG - Intergenic
1087046762 11:93849809-93849831 AGCAAATCTACTCAGTGCGCTGG + Intronic
1087614626 11:100473642-100473664 AGCAAATGTATTTAGTGTAAGGG - Intergenic
1088073164 11:105814478-105814500 AGCAAATGTTGTTTGTGTGTAGG + Intronic
1088642763 11:111889360-111889382 AGCAAGTGTACTTGGTGTGCTGG + Intergenic
1090669118 11:128933854-128933876 AGCACATGGCCTTGATGTGCAGG - Intergenic
1093512109 12:19941583-19941605 AGCTAATGTTCTTTGTGAGCTGG + Intergenic
1093821532 12:23625035-23625057 AGCAAATGTTTTAAGTGTGCAGG + Intronic
1094062243 12:26326617-26326639 AGCATATGAATTTGGTGTGTAGG + Intergenic
1094529834 12:31263860-31263882 AGCAAAAGTTCTTAGTGTACGGG - Intergenic
1095322732 12:40848706-40848728 AGCAAAGGTACTTGGTCTTTAGG + Intronic
1096949330 12:55449091-55449113 AGCAAATGTACTAGGAGTGTTGG + Intergenic
1101381165 12:104215387-104215409 AGCAAAAGTAGTTTGTGTGAAGG + Intergenic
1102653886 12:114463618-114463640 GGCAACTGAGCTTGGTGTGCAGG - Intergenic
1102682133 12:114698026-114698048 AGCAAATGCAATTGGTGGGTGGG + Intergenic
1106305239 13:28503902-28503924 AGCAAATGTACACGGTGTGCTGG - Intergenic
1107501351 13:40980034-40980056 AGCAAATGTAACTGCTTTGCAGG - Intronic
1107621640 13:42237857-42237879 AGAAAATCTCCTTGGTCTGCAGG - Intronic
1111924660 13:94449775-94449797 AACAAATGTAATTGGGATGCTGG + Intronic
1113469654 13:110535333-110535355 AGGAACTGTACCTGGTGTTCAGG - Intronic
1114915070 14:27253374-27253396 AGAATATGTACTGGGTGTCCTGG - Intergenic
1116986996 14:51231151-51231173 GGAAAATATACTTGGTGAGCTGG + Intergenic
1122451870 14:101815422-101815444 TGCGTATGTTCTTGGTGTGCAGG + Intronic
1125873503 15:43123615-43123637 AGAAAATGTAAATGATGTGCAGG + Intronic
1130642715 15:85693731-85693753 AGAAACTGTACTTTGAGTGCTGG + Intronic
1134145962 16:11762670-11762692 AGCAAATGTACCTGGAGCGCAGG - Exonic
1138630192 16:58287732-58287754 AGCAACTTTACTAGTTGTGCTGG - Intronic
1139439942 16:66961411-66961433 TGCAGAGGTACTTGGTGTGGAGG + Intronic
1141303036 16:82835795-82835817 ATTAAATGTCCTTGGTTTGCTGG - Intronic
1141707034 16:85671836-85671858 AGCAGATGTCCTTGGGGGGCAGG + Intronic
1143253905 17:5541835-5541857 AGTAATTGTTCTTGGTGGGCAGG - Exonic
1144820025 17:18065957-18065979 AGCAAATGTACTGAGTAAGCAGG - Exonic
1147115655 17:38297321-38297343 TGCAATTGTCCTTGGTGAGCTGG + Intronic
1148145478 17:45361944-45361966 TGCAGATGTTCTTGGTTTGCAGG + Intergenic
1148414026 17:47492299-47492321 TGCAATTGTCCTTGGTGAGCTGG - Intergenic
1149692810 17:58592185-58592207 AACAAATTTATTTGGTGTGTGGG - Intronic
1150258939 17:63773225-63773247 AGGAAATGTACAGTGTGTGCCGG - Intronic
1154132251 18:11747585-11747607 AGCAAATGTTCTTGTTGTGAAGG + Intronic
1155564527 18:27119186-27119208 GGCAAATGTACTTGGTTTGGTGG - Intronic
1156545280 18:37957807-37957829 AGAAAATGTTCTGAGTGTGCTGG - Intergenic
1160534074 18:79582252-79582274 AGCATATGTACGCTGTGTGCGGG - Intergenic
1163537495 19:17885299-17885321 AGAAAATGTTCTTGGTTGGCTGG - Intronic
1167739434 19:51315396-51315418 AGCAAATGTTCTTGGGGACCAGG + Intronic
926410511 2:12597486-12597508 GGCAGATGTAACTGGTGTGCCGG - Intergenic
926446778 2:12952527-12952549 AACAAATGTATTGGGTGGGCTGG - Intergenic
928803493 2:35123825-35123847 AGGAAATGTAATTAGTATGCAGG + Intergenic
929751292 2:44716346-44716368 AGCCAGTGATCTTGGTGTGCTGG + Intronic
930190633 2:48455572-48455594 AGCAAATGTAGTTGGTTTAGTGG + Intronic
930673832 2:54179221-54179243 ACCAAATGTAGGTGGTGTGAGGG + Intronic
931246770 2:60498608-60498630 AGCAAATAGGCTTAGTGTGCTGG + Intronic
931923715 2:67048122-67048144 AGCAAAGGTCCTTGGTGGGAAGG + Intergenic
932877821 2:75472032-75472054 TGCAAATGTACTTGGGATGAAGG + Intronic
933687228 2:85152170-85152192 AAGAAATGTACAAGGTGTGCTGG - Intronic
935842435 2:107128153-107128175 AGAAAATGGACTTGGGGTGGAGG - Intergenic
936469413 2:112785529-112785551 AGGAAATGAACTAGGTGTGATGG + Intergenic
940832478 2:158482681-158482703 AGCAAATTAACTGGGTGTGGTGG + Intronic
941380203 2:164783533-164783555 AGCACATGTCCTTGCTGGGCTGG + Intronic
943065523 2:183082110-183082132 AGCAAATGCTGTTGGTCTGCAGG - Intronic
943790933 2:191931585-191931607 AGCAAAGGCACTAGGTCTGCAGG + Intergenic
944454659 2:199880451-199880473 AACAAATGAACTGGGTGTGGTGG + Intergenic
944954494 2:204792657-204792679 AGTACATGTATTTGGTGTGGGGG - Intronic
946003122 2:216499362-216499384 AGCAAGTGTACTTGGCGTGCTGG - Exonic
948273537 2:236691676-236691698 AGCAAATGTGCTGGCTGGGCTGG - Intergenic
1170387631 20:15837056-15837078 CACATATGTACTTGGTCTGCAGG + Intronic
1173332203 20:42084800-42084822 AGCCAATGTACTGGAGGTGCTGG + Exonic
1173625107 20:44466725-44466747 AGCAAGTGTACTTGGCCTGCTGG + Intergenic
1177972825 21:27811289-27811311 GGCAAATGTTCTTGGTATGTGGG + Intergenic
1178665905 21:34545880-34545902 AGTGAATGCATTTGGTGTGCTGG - Intronic
1179310477 21:40191369-40191391 AGCAACTGTCCTTGATATGCAGG - Intronic
1184160606 22:42695102-42695124 AGCCAATGTACCTGGTGTGTTGG + Intronic
1184336759 22:43858390-43858412 AGCAAGTGTCCTGGGTCTGCGGG - Intronic
949707569 3:6836597-6836619 AGCAAATGCACCAGGTGTGGTGG - Intronic
951851545 3:27146785-27146807 AGGAAATGTATTGGGTGTGAGGG + Intronic
952236119 3:31481880-31481902 AGCAATTGTACTTGTTTTACAGG - Intergenic
953217165 3:40930425-40930447 AGCCAGTGGACTTGGTGGGCAGG + Intergenic
955784924 3:62527429-62527451 ACCAAATGTTCTGTGTGTGCTGG + Intronic
960297321 3:115960081-115960103 AGCATATGAACTTGGGGTGCAGG - Intronic
961696903 3:128711622-128711644 AGAAAATGAACTTGGGGTGGGGG + Intergenic
961950006 3:130739657-130739679 TGCAAATATGCTTGGTGTGGTGG - Intronic
964151596 3:153532015-153532037 AGCCAGTGGACTTGGTGGGCAGG + Intergenic
969592218 4:8128408-8128430 GGCAGCTGTACTGGGTGTGCAGG - Intronic
970885025 4:20978178-20978200 AACATATGTGTTTGGTGTGCAGG + Intronic
971636442 4:29065474-29065496 AGCCAATGTGATTGGTTTGCTGG + Intergenic
971824344 4:31601892-31601914 ATCAAATGTAATTGATTTGCTGG - Intergenic
974197635 4:58596612-58596634 AGCAAATGTATTTGTTGAGGAGG - Intergenic
975252864 4:72199207-72199229 AGCAGATGTTCTTGGTATGTAGG - Intergenic
976794299 4:88914972-88914994 AGGAACTGCATTTGGTGTGCTGG + Intronic
980444142 4:132884845-132884867 TGGAAATGTACTAGGGGTGCTGG + Intergenic
984411015 4:179398028-179398050 AGCAAAGTAACTTAGTGTGCAGG - Intergenic
984916056 4:184725822-184725844 AGCAAATGAACTTGGTGGAAAGG + Intronic
985877503 5:2611130-2611152 AGCAAACATACTCGCTGTGCTGG + Intergenic
989769888 5:45131427-45131449 AAGATATGTATTTGGTGTGCAGG + Intergenic
993669770 5:90746515-90746537 AGGACATGCTCTTGGTGTGCAGG - Intronic
994054894 5:95404072-95404094 AGCAAAGGTATTTGGTCTCCCGG - Intronic
999041445 5:148417659-148417681 AGCTAATGTACTTAATCTGCAGG - Intronic
999723412 5:154415827-154415849 AGCAGAACTTCTTGGTGTGCTGG - Exonic
1002956519 6:1870472-1870494 TGCAGCTGTGCTTGGTGTGCGGG - Intronic
1004050129 6:12069204-12069226 AGTAAATGAACATGCTGTGCAGG - Intronic
1008200337 6:48579919-48579941 AACAAATGCACTTGGTTTGAAGG + Intergenic
1009580597 6:65528338-65528360 ACAAAATGTATTTGCTGTGCAGG + Intronic
1010487379 6:76431789-76431811 AGAAAATGTGCTTGATGTGAAGG + Intergenic
1014341554 6:120214044-120214066 GGCAAATGTTTTTGGTGTGCTGG - Intergenic
1018394016 6:163363293-163363315 AGCAAGTATACTTGACGTGCTGG - Intergenic
1022480589 7:30740819-30740841 GGCAAATGTGCCTGGGGTGCTGG + Intronic
1024410271 7:49032437-49032459 AGCCAGTGTACTTGATATGCTGG - Intergenic
1030217273 7:107057246-107057268 AGCAAAGGTATTTGGTAAGCGGG - Intronic
1032198240 7:129801643-129801665 AACAAATGTAGCTGGTGTTCTGG + Intergenic
1033112719 7:138596343-138596365 AGCAAATGAACTTGGTATATGGG - Intronic
1033186063 7:139227716-139227738 AGCAAATGTACTTGGCGTACTGG + Intergenic
1035492494 7:159292520-159292542 AGCAAATCACCTTGGTGTGCTGG - Intergenic
1037032359 8:14124754-14124776 AGCAGATTTATTTAGTGTGCTGG - Intronic
1037429574 8:18795366-18795388 ACCAATTGTACATGGTGGGCTGG + Intronic
1040362659 8:46682716-46682738 TGATAATGTACTTGGTGTGTGGG + Intergenic
1040447630 8:47511692-47511714 GGCAAATGGTCTTGGTGTACTGG + Intronic
1043429328 8:80179476-80179498 AGCACATGTAGGTGGGGTGCAGG - Intronic
1044426849 8:92062184-92062206 ATCATCTGTACTTGGTGTCCTGG - Intronic
1045271455 8:100665290-100665312 GGGAAATGTACTTAGTGTACAGG + Intergenic
1053612603 9:39730031-39730053 AGCAAATGGGCTGGGTGTGGTGG - Intergenic
1053870642 9:42487989-42488011 AGCAAATGGGCTGGGTGTGGGGG - Intergenic
1054085650 9:60741127-60741149 AGCAAATGGGCTGGGTGTGGTGG + Intergenic
1054240912 9:62612362-62612384 AGCAAATGGGCTGGGTGTGGTGG + Intergenic
1054555044 9:66646886-66646908 AGCAAATGGGCTGGGTGTGGTGG + Intergenic
1057433232 9:95014870-95014892 AGAAAATGTACTGGTTGTTCAGG - Intronic
1057916271 9:99057952-99057974 GGGAAATGTACTGGGTGTGAAGG + Intronic
1061243333 9:129387023-129387045 AGCAAATGCACTTGGTGCTGAGG - Intergenic
1189558911 X:42172723-42172745 AAGAGATATACTTGGTGTGCTGG + Intergenic
1193837316 X:86359836-86359858 ATCAAATGTACTCGCTGGGCAGG - Intronic
1194171083 X:90583120-90583142 ATCAAATGTACTTGCTGTTTTGG - Intergenic
1194444000 X:93965563-93965585 AGCGAATGAACTTGGAGTGGGGG - Intergenic
1194725798 X:97395418-97395440 AGTAAATGTATATTGTGTGCTGG - Intronic
1194915231 X:99698791-99698813 AGAAAATGTGCTGGGCGTGCAGG - Intergenic
1195684517 X:107573429-107573451 AGGAAATGAACTTGGGGGGCAGG - Intronic
1197857474 X:130931657-130931679 TGCAACTGTTCTTGCTGTGCAGG + Intergenic
1199623150 X:149716580-149716602 AGGAAAAGTACCTGGTGTACCGG + Exonic
1199627969 X:149758060-149758082 AGGAAAAGTACCTGGTGTACCGG - Intergenic
1200517314 Y:4160864-4160886 ATCAAATGTACTTGCTGTTTTGG - Intergenic