ID: 1080014638

View in Genome Browser
Species Human (GRCh38)
Location 11:27491573-27491595
Sequence TTAGGTTGTCAGTTACTGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080014638_1080014644 20 Left 1080014638 11:27491573-27491595 CCATGCAGTAACTGACAACCTAA No data
Right 1080014644 11:27491616-27491638 CTTAGGTGCTCATGAGTCCAGGG No data
1080014638_1080014646 22 Left 1080014638 11:27491573-27491595 CCATGCAGTAACTGACAACCTAA No data
Right 1080014646 11:27491618-27491640 TAGGTGCTCATGAGTCCAGGGGG No data
1080014638_1080014639 -10 Left 1080014638 11:27491573-27491595 CCATGCAGTAACTGACAACCTAA No data
Right 1080014639 11:27491586-27491608 GACAACCTAAAGTGAAGAAACGG No data
1080014638_1080014645 21 Left 1080014638 11:27491573-27491595 CCATGCAGTAACTGACAACCTAA No data
Right 1080014645 11:27491617-27491639 TTAGGTGCTCATGAGTCCAGGGG No data
1080014638_1080014641 -5 Left 1080014638 11:27491573-27491595 CCATGCAGTAACTGACAACCTAA No data
Right 1080014641 11:27491591-27491613 CCTAAAGTGAAGAAACGGCTAGG No data
1080014638_1080014643 19 Left 1080014638 11:27491573-27491595 CCATGCAGTAACTGACAACCTAA No data
Right 1080014643 11:27491615-27491637 GCTTAGGTGCTCATGAGTCCAGG No data
1080014638_1080014642 3 Left 1080014638 11:27491573-27491595 CCATGCAGTAACTGACAACCTAA No data
Right 1080014642 11:27491599-27491621 GAAGAAACGGCTAGGTGCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080014638 Original CRISPR TTAGGTTGTCAGTTACTGCA TGG (reversed) Intergenic
No off target data available for this crispr