ID: 1080016673

View in Genome Browser
Species Human (GRCh38)
Location 11:27514460-27514482
Sequence CAGGATGCACAACCTGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080016673_1080016676 14 Left 1080016673 11:27514460-27514482 CCCTCTTCAGGTTGTGCATCCTG No data
Right 1080016676 11:27514497-27514519 AGCCACACAATGTATTGTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080016673 Original CRISPR CAGGATGCACAACCTGAAGA GGG (reversed) Intergenic
No off target data available for this crispr