ID: 1080016676

View in Genome Browser
Species Human (GRCh38)
Location 11:27514497-27514519
Sequence AGCCACACAATGTATTGTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080016675_1080016676 -5 Left 1080016675 11:27514479-27514501 CCTGCACAATGTATTTTCAGCCA No data
Right 1080016676 11:27514497-27514519 AGCCACACAATGTATTGTTCAGG No data
1080016674_1080016676 13 Left 1080016674 11:27514461-27514483 CCTCTTCAGGTTGTGCATCCTGC No data
Right 1080016676 11:27514497-27514519 AGCCACACAATGTATTGTTCAGG No data
1080016673_1080016676 14 Left 1080016673 11:27514460-27514482 CCCTCTTCAGGTTGTGCATCCTG No data
Right 1080016676 11:27514497-27514519 AGCCACACAATGTATTGTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080016676 Original CRISPR AGCCACACAATGTATTGTTC AGG Intergenic
No off target data available for this crispr