ID: 1080020138

View in Genome Browser
Species Human (GRCh38)
Location 11:27551630-27551652
Sequence GACAGCTCTGGGCCTGCTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080020138_1080020141 11 Left 1080020138 11:27551630-27551652 CCAGTAGCAGGCCCAGAGCTGTC No data
Right 1080020141 11:27551664-27551686 GAATCATTACCTGCAGATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080020138 Original CRISPR GACAGCTCTGGGCCTGCTAC TGG (reversed) Intergenic
No off target data available for this crispr