ID: 1080030358

View in Genome Browser
Species Human (GRCh38)
Location 11:27654254-27654276
Sequence AAAAGGATTTGCCTCCGTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080030358_1080030361 6 Left 1080030358 11:27654254-27654276 CCATCACGGAGGCAAATCCTTTT No data
Right 1080030361 11:27654283-27654305 CCTAGCAATCTGTTAGATTGTGG No data
1080030358_1080030362 7 Left 1080030358 11:27654254-27654276 CCATCACGGAGGCAAATCCTTTT No data
Right 1080030362 11:27654284-27654306 CTAGCAATCTGTTAGATTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080030358 Original CRISPR AAAAGGATTTGCCTCCGTGA TGG (reversed) Intergenic