ID: 1080030358 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 11:27654254-27654276 |
Sequence | AAAAGGATTTGCCTCCGTGA TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1080030358_1080030362 | 7 | Left | 1080030358 | 11:27654254-27654276 | CCATCACGGAGGCAAATCCTTTT | No data | ||
Right | 1080030362 | 11:27654284-27654306 | CTAGCAATCTGTTAGATTGTGGG | No data | ||||
1080030358_1080030361 | 6 | Left | 1080030358 | 11:27654254-27654276 | CCATCACGGAGGCAAATCCTTTT | No data | ||
Right | 1080030361 | 11:27654283-27654305 | CCTAGCAATCTGTTAGATTGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1080030358 | Original CRISPR | AAAAGGATTTGCCTCCGTGA TGG (reversed) | Intergenic | ||