ID: 1080030361

View in Genome Browser
Species Human (GRCh38)
Location 11:27654283-27654305
Sequence CCTAGCAATCTGTTAGATTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080030354_1080030361 22 Left 1080030354 11:27654238-27654260 CCCAGCGGCTTGGCAGCCATCAC No data
Right 1080030361 11:27654283-27654305 CCTAGCAATCTGTTAGATTGTGG No data
1080030358_1080030361 6 Left 1080030358 11:27654254-27654276 CCATCACGGAGGCAAATCCTTTT No data
Right 1080030361 11:27654283-27654305 CCTAGCAATCTGTTAGATTGTGG No data
1080030355_1080030361 21 Left 1080030355 11:27654239-27654261 CCAGCGGCTTGGCAGCCATCACG No data
Right 1080030361 11:27654283-27654305 CCTAGCAATCTGTTAGATTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080030361 Original CRISPR CCTAGCAATCTGTTAGATTG TGG Intergenic
No off target data available for this crispr