ID: 1080034849

View in Genome Browser
Species Human (GRCh38)
Location 11:27700352-27700374
Sequence AGCGCCTCGGGCTCCCGGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 204}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080034849_1080034864 17 Left 1080034849 11:27700352-27700374 CCGGCCCGGGAGCCCGAGGCGCT 0: 1
1: 0
2: 2
3: 16
4: 204
Right 1080034864 11:27700392-27700414 GCGAGCGGGCGGGTGCGCCCGGG 0: 1
1: 0
2: 2
3: 24
4: 251
1080034849_1080034866 25 Left 1080034849 11:27700352-27700374 CCGGCCCGGGAGCCCGAGGCGCT 0: 1
1: 0
2: 2
3: 16
4: 204
Right 1080034866 11:27700400-27700422 GCGGGTGCGCCCGGGCGCGGCGG 0: 1
1: 0
2: 3
3: 65
4: 754
1080034849_1080034862 7 Left 1080034849 11:27700352-27700374 CCGGCCCGGGAGCCCGAGGCGCT 0: 1
1: 0
2: 2
3: 16
4: 204
Right 1080034862 11:27700382-27700404 GCGCGGGACAGCGAGCGGGCGGG 0: 1
1: 0
2: 1
3: 22
4: 207
1080034849_1080034861 6 Left 1080034849 11:27700352-27700374 CCGGCCCGGGAGCCCGAGGCGCT 0: 1
1: 0
2: 2
3: 16
4: 204
Right 1080034861 11:27700381-27700403 TGCGCGGGACAGCGAGCGGGCGG 0: 1
1: 0
2: 0
3: 15
4: 107
1080034849_1080034865 22 Left 1080034849 11:27700352-27700374 CCGGCCCGGGAGCCCGAGGCGCT 0: 1
1: 0
2: 2
3: 16
4: 204
Right 1080034865 11:27700397-27700419 CGGGCGGGTGCGCCCGGGCGCGG 0: 1
1: 0
2: 1
3: 59
4: 386
1080034849_1080034859 2 Left 1080034849 11:27700352-27700374 CCGGCCCGGGAGCCCGAGGCGCT 0: 1
1: 0
2: 2
3: 16
4: 204
Right 1080034859 11:27700377-27700399 GGGGTGCGCGGGACAGCGAGCGG 0: 1
1: 0
2: 1
3: 18
4: 195
1080034849_1080034857 -10 Left 1080034849 11:27700352-27700374 CCGGCCCGGGAGCCCGAGGCGCT 0: 1
1: 0
2: 2
3: 16
4: 204
Right 1080034857 11:27700365-27700387 CCGAGGCGCTACGGGGTGCGCGG 0: 1
1: 0
2: 1
3: 3
4: 60
1080034849_1080034863 16 Left 1080034849 11:27700352-27700374 CCGGCCCGGGAGCCCGAGGCGCT 0: 1
1: 0
2: 2
3: 16
4: 204
Right 1080034863 11:27700391-27700413 AGCGAGCGGGCGGGTGCGCCCGG 0: 1
1: 0
2: 1
3: 18
4: 153
1080034849_1080034860 3 Left 1080034849 11:27700352-27700374 CCGGCCCGGGAGCCCGAGGCGCT 0: 1
1: 0
2: 2
3: 16
4: 204
Right 1080034860 11:27700378-27700400 GGGTGCGCGGGACAGCGAGCGGG 0: 1
1: 0
2: 2
3: 6
4: 153
1080034849_1080034867 28 Left 1080034849 11:27700352-27700374 CCGGCCCGGGAGCCCGAGGCGCT 0: 1
1: 0
2: 2
3: 16
4: 204
Right 1080034867 11:27700403-27700425 GGTGCGCCCGGGCGCGGCGGCGG 0: 1
1: 0
2: 2
3: 45
4: 461
1080034849_1080034858 -9 Left 1080034849 11:27700352-27700374 CCGGCCCGGGAGCCCGAGGCGCT 0: 1
1: 0
2: 2
3: 16
4: 204
Right 1080034858 11:27700366-27700388 CGAGGCGCTACGGGGTGCGCGGG 0: 1
1: 0
2: 0
3: 3
4: 41

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080034849 Original CRISPR AGCGCCTCGGGCTCCCGGGC CGG (reversed) Intronic