ID: 1080034983

View in Genome Browser
Species Human (GRCh38)
Location 11:27700784-27700806
Sequence CGCGGGACGCGGGGTTCCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 89}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080034983_1080034996 10 Left 1080034983 11:27700784-27700806 CCCGGGGAACCCCGCGTCCCGCG 0: 1
1: 0
2: 0
3: 8
4: 89
Right 1080034996 11:27700817-27700839 AAACCCCGGCTGTGGGCGCTGGG 0: 1
1: 0
2: 0
3: 9
4: 95
1080034983_1080034997 11 Left 1080034983 11:27700784-27700806 CCCGGGGAACCCCGCGTCCCGCG 0: 1
1: 0
2: 0
3: 8
4: 89
Right 1080034997 11:27700818-27700840 AACCCCGGCTGTGGGCGCTGGGG 0: 1
1: 0
2: 1
3: 18
4: 160
1080034983_1080034995 9 Left 1080034983 11:27700784-27700806 CCCGGGGAACCCCGCGTCCCGCG 0: 1
1: 0
2: 0
3: 8
4: 89
Right 1080034995 11:27700816-27700838 GAAACCCCGGCTGTGGGCGCTGG 0: 1
1: 0
2: 1
3: 18
4: 139
1080034983_1080035004 19 Left 1080034983 11:27700784-27700806 CCCGGGGAACCCCGCGTCCCGCG 0: 1
1: 0
2: 0
3: 8
4: 89
Right 1080035004 11:27700826-27700848 CTGTGGGCGCTGGGGCGGGAGGG 0: 1
1: 0
2: 1
3: 55
4: 552
1080034983_1080034993 2 Left 1080034983 11:27700784-27700806 CCCGGGGAACCCCGCGTCCCGCG 0: 1
1: 0
2: 0
3: 8
4: 89
Right 1080034993 11:27700809-27700831 CTCTGCAGAAACCCCGGCTGTGG 0: 1
1: 1
2: 6
3: 16
4: 213
1080034983_1080035000 14 Left 1080034983 11:27700784-27700806 CCCGGGGAACCCCGCGTCCCGCG 0: 1
1: 0
2: 0
3: 8
4: 89
Right 1080035000 11:27700821-27700843 CCCGGCTGTGGGCGCTGGGGCGG 0: 1
1: 0
2: 1
3: 30
4: 418
1080034983_1080035002 15 Left 1080034983 11:27700784-27700806 CCCGGGGAACCCCGCGTCCCGCG 0: 1
1: 0
2: 0
3: 8
4: 89
Right 1080035002 11:27700822-27700844 CCGGCTGTGGGCGCTGGGGCGGG 0: 1
1: 0
2: 3
3: 58
4: 575
1080034983_1080034990 -4 Left 1080034983 11:27700784-27700806 CCCGGGGAACCCCGCGTCCCGCG 0: 1
1: 0
2: 0
3: 8
4: 89
Right 1080034990 11:27700803-27700825 CGCGCCCTCTGCAGAAACCCCGG 0: 1
1: 0
2: 2
3: 5
4: 137
1080034983_1080035003 18 Left 1080034983 11:27700784-27700806 CCCGGGGAACCCCGCGTCCCGCG 0: 1
1: 0
2: 0
3: 8
4: 89
Right 1080035003 11:27700825-27700847 GCTGTGGGCGCTGGGGCGGGAGG 0: 1
1: 0
2: 11
3: 103
4: 1026
1080034983_1080034994 3 Left 1080034983 11:27700784-27700806 CCCGGGGAACCCCGCGTCCCGCG 0: 1
1: 0
2: 0
3: 8
4: 89
Right 1080034994 11:27700810-27700832 TCTGCAGAAACCCCGGCTGTGGG 0: 1
1: 0
2: 2
3: 14
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080034983 Original CRISPR CGCGGGACGCGGGGTTCCCC GGG (reversed) Intronic
900660338 1:3778923-3778945 GGCGGCACGGGGGCTTCCCCAGG - Exonic
905169195 1:36099406-36099428 CCCGGGCCTCGGGGTCCCCCTGG - Exonic
908241923 1:62195180-62195202 CGAAGGGCGCGGGGTGCCCCGGG + Intronic
914802969 1:150974179-150974201 AGCGGCCCGCGGGGTTGCCCTGG - Intronic
915416263 1:155745606-155745628 CGCGAGAGGCGGGGCTCCACGGG - Intergenic
922851382 1:228736073-228736095 CGAGGGTCGCGAGGTTCCCAAGG + Intronic
1073057124 10:100710049-100710071 CGCGGGGCGCGGGTTTCTCCCGG - Intergenic
1075334521 10:121598565-121598587 CGCGGGACTCGGGGCGGCCCGGG - Intergenic
1076554184 10:131311455-131311477 CGCGGGGGTCGTGGTTCCCCCGG - Exonic
1077010306 11:376568-376590 CCCGGGACGGGGGGACCCCCAGG + Exonic
1080034983 11:27700784-27700806 CGCGGGACGCGGGGTTCCCCGGG - Intronic
1084522758 11:69674740-69674762 CGCAGCACGAGGGGCTCCCCAGG + Intronic
1090410802 11:126508422-126508444 TGCGGGTCTCGGGGCTCCCCAGG + Intronic
1095958306 12:47819067-47819089 CGCGGGAAGCGGGGCGCCGCAGG - Intronic
1100469044 12:94873800-94873822 CGCTGGCCGCGGGGTCCCCGGGG + Intergenic
1104602081 12:130161373-130161395 CGCGGGAGCTGGGGGTCCCCGGG + Intergenic
1105557364 13:21459419-21459441 CGCGGGCCGCGGGCCGCCCCCGG + Intergenic
1113542019 13:111115919-111115941 CGCGGGCGGCGGGGGTCCCCGGG + Intronic
1114649015 14:24271453-24271475 CGCGGGGGGCGGGGGTGCCCGGG - Exonic
1117913117 14:60652968-60652990 CGCGGGGAGCGGCGTCCCCCAGG - Intronic
1118796707 14:69151766-69151788 CGCGGGGCCCGGGCCTCCCCGGG + Intronic
1120953442 14:90062038-90062060 CGCAGGCCGCGAGGCTCCCCCGG - Exonic
1122269740 14:100563445-100563467 AGCGAGACGCGGCGTCCCCCAGG + Intronic
1122317553 14:100835041-100835063 GGCGGGCCGGGGGGTTGCCCAGG + Intergenic
1122904330 14:104795133-104795155 TGCGGGCCGTGGGGCTCCCCGGG - Intronic
1124340255 15:28885814-28885836 CTCGGGACCCCGGGTCCCCCCGG - Intronic
1127753457 15:62068078-62068100 CGGGGGCCGCGGGGGTCGCCGGG - Exonic
1128149636 15:65355163-65355185 CGCGGGGGCCGGGCTTCCCCAGG - Intronic
1133350500 16:5097839-5097861 GGCGGGGCCCGGGGGTCCCCCGG + Intergenic
1134656198 16:15949877-15949899 AGCGGGGAGCGGGGTGCCCCGGG - Intronic
1139544687 16:67644823-67644845 GGTGGGCCGCGGGGATCCCCAGG + Intergenic
1141690139 16:85592038-85592060 CGGGGGGCGGGGGGTGCCCCTGG - Intergenic
1142395382 16:89828695-89828717 CGCGGGCTGCGGGGCTCGCCGGG + Exonic
1143150761 17:4806841-4806863 CGCGCAGCGCGGGGTGCCCCGGG + Intergenic
1143731595 17:8885473-8885495 CTGGGGAGGCGGGGTTACCCAGG - Intronic
1143731664 17:8885637-8885659 CTGGGGAGGCGGGGTTACCCAGG - Intronic
1143731746 17:8885818-8885840 CTGGGGAGGCGGGGTTACCCAGG - Intronic
1145828277 17:27893439-27893461 CGCGGGACTCGGGGTCCTACTGG + Intronic
1152468499 17:80478192-80478214 TGCGGGCCGCGGGGTCCCTCTGG - Intergenic
1159045589 18:63366743-63366765 CGCCGGCCGCAGGGTTCCCGGGG - Intronic
1163843931 19:19628223-19628245 CGCGGGAGGCGGGGTCTCCCCGG + Intronic
1166121628 19:40690490-40690512 CGCGGGAGGCGGGGGCGCCCGGG - Exonic
1168105704 19:54164645-54164667 CGCGGGCCTCCCGGTTCCCCAGG + Intronic
930198359 2:48530313-48530335 CCCGGGACGCGGGCATCTCCAGG + Intronic
931321465 2:61177665-61177687 CGCGGGAGCCGGGGCTGCCCTGG + Exonic
933751108 2:85602540-85602562 CCCGGGACGCGAGAGTCCCCAGG + Intronic
935939220 2:108221090-108221112 AGCAGGACACGGGGTTCCCAAGG + Intergenic
947399105 2:229714555-229714577 TGCGGGATCCGCGGTTCCCCGGG + Exonic
947992248 2:234497001-234497023 CCCGGAGCGCGGGCTTCCCCGGG + Exonic
948718480 2:239881383-239881405 GGAGGGAGGCCGGGTTCCCCAGG - Intergenic
1172118272 20:32584056-32584078 CGCGGGACGGGGAGTCCGCCGGG - Intronic
1179522535 21:41954192-41954214 CGCGGGCCGCGAGGTGACCCGGG + Intergenic
1181006632 22:20016660-20016682 CGCGGGGAGCGGCGTTCCCAGGG + Exonic
1181811233 22:25405020-25405042 CCCGGGACGCGGCGTCCCCGGGG + Intronic
1183546038 22:38455305-38455327 CGCGGGCGGCGGGGCGCCCCGGG - Intergenic
1184046794 22:41976982-41977004 AGCGGGGCGCGGGCTTCCCCGGG - Exonic
1184766825 22:46576691-46576713 CCCGGGACGCGGGTTTCCACCGG + Intronic
1185255219 22:49827803-49827825 CGCGGGACGCGGGGCTGGCTCGG + Intergenic
1185375888 22:50482403-50482425 GAGGGGACGCGGGCTTCCCCTGG + Intronic
950923493 3:16717531-16717553 CTGGGGAGGCGGGGTTCCCTTGG + Intergenic
957078650 3:75619690-75619712 CGCGGGATGCGGGGCTGCCGCGG + Intergenic
961446241 3:126983046-126983068 CGCGCGGCGCGGGGCTCCGCGGG + Intergenic
961827220 3:129605493-129605515 CGCGGGCCGCGGGGGACCCCTGG + Exonic
962367439 3:134795753-134795775 CGCGGTTCGCGGGGTTCCTCTGG + Intronic
966712008 3:182980693-182980715 CCCCGGGCGCGGGGGTCCCCCGG + Intronic
967110467 3:186288805-186288827 CGAGGGACGGGGGGTTCCAGGGG + Exonic
968230544 3:197002754-197002776 CAGGGCACGCGGCGTTCCCCGGG + Exonic
968463308 4:736731-736753 CACGGGACGCGGGGAACCCGGGG + Intronic
969362611 4:6674266-6674288 CGCGGGGCGCGGGGCTCAGCGGG - Intergenic
969573423 4:8023234-8023256 CACGGGATTCGGGTTTCCCCGGG + Intronic
975118626 4:70705365-70705387 CGCGGGAGGCGGAGCTCCGCGGG - Intronic
976276601 4:83284732-83284754 CGCGAGCCGCGGGGTTCGCGCGG - Exonic
983656517 4:170090083-170090105 CGCAGGGCGCGGGGTAGCCCAGG + Intronic
990347450 5:54884132-54884154 CGCGGGACGCGGGGCCGCCGCGG - Intergenic
999300275 5:150486337-150486359 AGCGGGACGCCTGGGTCCCCCGG - Intronic
1006634545 6:35452553-35452575 CACCGGACGCGGGGCTCCCTGGG + Exonic
1010244827 6:73653580-73653602 CGCGGCCCCCGGGGTTCCCGAGG + Intronic
1019474764 7:1238751-1238773 GAGGGGACGCGGGGTTCCCATGG + Intergenic
1019528606 7:1492856-1492878 AGCGGGGCGCGGGCTTACCCGGG + Intronic
1019528633 7:1492924-1492946 AGCGGGGCGCGGGCTTACCCGGG + Intronic
1019528647 7:1492958-1492980 AGCGGGGCGCGGGCTTACCCGGG + Intronic
1019918471 7:4148423-4148445 TGCGGGACGCGGGGTGCCTGGGG - Intronic
1020080332 7:5283095-5283117 CGCGGGACGCGGGGAGACGCCGG + Intronic
1020137393 7:5594603-5594625 CTCGGGTCCCGAGGTTCCCCAGG + Intronic
1025198584 7:56949084-56949106 CGCGGGACGCGGGGAGACGCCGG - Intergenic
1025673368 7:63627852-63627874 CGCGGGACGCGGGGAGACGCCGG + Intergenic
1031043421 7:116862457-116862479 CGAGGGAGGCGGGGCTCCCGGGG + Exonic
1034344809 7:150379538-150379560 CGCGGGGCTCGGGGCACCCCAGG - Intronic
1035250703 7:157595282-157595304 CGATGTACGCGGGGTTCCTCGGG + Exonic
1035580601 8:737477-737499 CGCGGGGCGCGCGGGTCACCCGG - Intronic
1035743119 8:1944051-1944073 TGCGGGAGGCTGGGGTCCCCAGG - Intronic
1036910490 8:12754441-12754463 CGCTCGGCGCGGGGTTCCCTCGG - Intronic
1055265950 9:74496982-74497004 CAAGAGACGCGGGGCTCCCCGGG - Intergenic
1057546032 9:96021125-96021147 CTTGGCCCGCGGGGTTCCCCGGG - Intergenic
1061149101 9:128818847-128818869 CCCGGGCCGCGGGGTCCCCCGGG - Exonic
1062542042 9:137045837-137045859 CGCAGGCCGCGGGGCGCCCCGGG - Intronic
1195923190 X:110002694-110002716 CGCCGGGCGCTCGGTTCCCCTGG - Intronic
1200126787 X:153819016-153819038 CGCGGGAAGCGGGGCGCCCTAGG + Intronic